Morpholino
MO2-etsrp
- ID
- ZDB-MRPHLNO-060407-3
- Name
- MO2-etsrp
- Previous Names
- Target
- Sequence
-
5' - CACTGAGTCCTTATTTCACTATATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-etsrp
No data available
Phenotype
Phenotype resulting from MO2-etsrp
1 - 5 of 35 Show all
Phenotype of all Fish created by or utilizing MO2-etsrp
1 - 5 of 134 Show all
Citations
- Nakajima, H., Ishikawa, H., Yamamoto, T., Chiba, A., Fukui, H., Sako, K., Fukumoto, M., Mattonet, K., Kwon, H.B., Hui, S.P., Dobreva, G.D., Kikuchi, K., Helker, C.S.M., Stainier, D.Y.R., Mochizuki, N. (2023) Endoderm-derived islet1-expressing cells differentiate into endothelial cells to function as the vascular HSPC niche in zebrafish. Developmental Cell. 58(3):224-238.e7
- Metikala, S., Warkala, M., Casie Chetty, S., Chestnut, B., Rufin Florat, D., Plender, E., Nester, O., Koenig, A.L., Astrof, S., Sumanas, S. (2022) Integration of vascular progenitors into functional blood vessels represents a distinct mechanism of vascular growth. Developmental Cell. 57(6):767-782.e6
- Wu, M., Chen, Q., Li, J., Xu, Y., Lian, J., Liu, Y., Meng, P., Zhang, Y. (2022) Gfi1aa/Lsd1 Facilitates Hemangioblast Differentiation Into Primitive Erythrocytes by Targeting etv2 and sox7 in Zebrafish. Frontiers in cell and developmental biology. 9:786426
- Zhao, S., Feng, S., Tian, Y., Wen, Z. (2022) Hemogenic and aortic endothelium arise from a common hemogenic angioblast precursor and are specified by the Etv2 dosage. Proceedings of the National Academy of Sciences of the United States of America. 119:e2119051119e2119051119
- Liu, K.C., Villasenor, A., Bertuzzi, M., Schmitner, N., Radros, N., Rautio, L., Mattonet, K., Matsuoka, R.L., Reischauer, S., Stainier, D.Y., Andersson, O. (2021) Insulin-producing β-cells regenerate ectopically from a mesodermal origin under the perturbation of hemato-endothelial specification. eLIFE. 10:
- Chestnut, B., Casie Chetty, S., Koenig, A.L., Sumanas, S. (2020) Single-cell transcriptomic analysis identifies the conversion of zebrafish Etv2-deficient vascular progenitors into skeletal muscle. Nature communications. 11:2796
- Chetty, S.C., Sumanas, S. (2020) Ets1 functions partially redundantly with Etv2 to promote embryonic vasculogenesis and angiogenesis in zebrafish. Developmental Biology. 465(1):11-22
- Rajan, A.M., Ma, R.C., Kocha, K.M., Zhang, D.J., Huang, P. (2020) Dual function of perivascular fibroblasts in vascular stabilization in zebrafish. PLoS Genetics. 16:e1008800
- Pociute, K., Schumacher, J.A., Sumanas, S. (2019) Clec14a genetically interacts with Etv2 and Vegf signaling during vasculogenesis and angiogenesis in zebrafish. BMC Developmental Biology. 19:6
- Davis, J.A., Koenig, A.L., Lubert, A., Chestnut, B., Liu, F., Desai, S.P., Winkler, T., Pociute, K., Choi, K., Sumanas, S. (2018) ETS transcription factor Etsrp / Etv2 is required for lymphangiogenesis and directly regulates vegfr3 / flt4 expression. Developmental Biology. 440(1):40-52
1 - 10 of 40
Show