Morpholino
MO1-wnt8a
- ID
- ZDB-MRPHLNO-041217-12
- Name
- MO1-wnt8a
- Previous Names
- Target
- Sequence
-
5' - ACGCAAAAATCTGGCAAGGGTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt8a
No data available
Phenotype
Phenotype resulting from MO1-wnt8a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-wnt8a
1 - 5 of 128 Show all
Citations
- He, M., Zhang, R., Jiao, S., Zhang, F., Ye, D., Wang, H., Sun, Y. (2020) Nanog safeguards early embryogenesis against global activation of maternal β-catenin activity by interfering with TCF factors. PLoS Biology. 18:e3000561
- He, X., Zhang, W., Yan, C., Nie, F., Li, C., Liu, X., Fei, C., Li, S., Song, X., Jia, Y., Zeng, R., Wu, D., Pan, W., Hao, X., Li, L. (2017) Chemical biology reveals CARF as a positive regulator of canonical Wnt signaling by promoting TCF/β-catenin transcriptional activity. Cell discovery. 3:17003
- Hübner, K., Grassme, K.S., Rao, J., Wenke, N.K., Zimmer, C.L., Korte, L., Mu Ller, K., Sumanas, S., Greber, B., Herzog, W. (2017) Wnt Signaling Positively Regulates Endothelial Cell Fate Specification in the Fli1a-Positive Progenitor Population via Lef1. Developmental Biology. 430(1):142-155
- Mandal, A., Holowiecki, A., Song, Y.C., Waxman, J.S. (2017) Wnt signaling balances specification of the cardiac and pharyngeal muscle fields. Mechanisms of Development. 143:32-41
- Naylor, R.W., Han, H.I., Hukriede, N.A., Davidson, A.J. (2017) Wnt8a expands the pool of embryonic kidney progenitors in zebrafish. Developmental Biology. 425(2):130-141
- Dutta, S., Sriskanda, S., Boobalan, E., Alur, R.P., Elkahloun, A., Brooks, B.P. (2015) nlz1 Is required for cilia formation in zebrafish embryogenesis. Developmental Biology. 406(2):203-11
- Stanganello, E., Hagemann, A.I., Mattes, B., Sinner, C., Meyen, D., Weber, S., Schug, A., Raz, E., Scholpp, S. (2015) Filopodia-based Wnt transport during vertebrate tissue patterning. Nature communications. 6:5846
- Lu, F.I., Sun, Y.H., Wei, C.Y., Thisse, C., Thisse, B. (2014) Tissue-specific derepression of TCF/LEF controls the activity of the Wnt/β-catenin pathway. Nature communications. 5:5368
- Wylie, A.D., Fleming, J.A., Whitener, A.E., and Lekven, A.C. (2014) Post-transcriptional regulation of wnt8a is essential to zebrafish axis development. Developmental Biology. 386(1):53-63
- Guan, R., Ei-Rass, S., Spillane, D., Lam, S., Wang, Y., Wu, J., Chen, Z., Wang, A., Jia, Z., Keating, A., Hu, J., and Wen, X.Y. (2013) rbm 47, a novel RNA binding protein, regulates zebrafish head development. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(12):1395-404
1 - 10 of 43
Show