Morpholino
MO1-myod1
- ID
- ZDB-MRPHLNO-070118-1
- Name
- MO1-myod1
- Previous Names
-
- MO1-myod
- Target
- Sequence
-
5' - ATATCCGACAACTCCATCTTTTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myod1
No data available
Phenotype
Phenotype resulting from MO1-myod1
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-myod1
1 - 5 of 31 Show all
Citations
- Paulissen, E., Martin, B.L. (2022) Myogenic regulatory factors myod and Myf5 are required for dorsal aorta formation and angiogenic sprouting. Developmental Biology. 490:134-143
- Row, R.H., Pegg, A., Kinney, B., Farr, G.H., Maves, L., Lowell, S., Wilson, V., Martin, B.L. (2018) BMP and FGF signaling interact to pattern mesoderm by controlling basic helix-loop-helix transcription factor activity. eLIFE. 7
- Chen, J.W., Galloway, J.L. (2014) The development of zebrafish tendon and ligament progenitors. Development (Cambridge, England). 141:2035-45
- Devakanmalai, G.S., Zumrut, H.E., and Ozbudak, E.M. (2013) Cited3 activates Mef2c to control muscle cell differentiation and survival. Biology Open. 2(5):505-514
- Lin, C.Y., Lee, H.C., Chen, H.C., Hsieh, C.C., and Tsai, H.J. (2013) Normal Function of Myf5 During Gastrulation Is Required for Pharyngeal Arch Cartilage Development in Zebrafish Embryos. Zebrafish. 10(4):486-99
- Minchin, J.E., Williams, V.C., Hinits, Y., Low, S., Tandon, P., Fan, C.M., Rawls, J.F., and Hughes, S.M. (2013) Oesophageal and sternohyal muscle fibres are novel Pax3-dependent migratory somite derivatives essential for ingestion. Development (Cambridge, England). 140(14):2972-2984
- Nord, H., Skalman, L.N., and von Hofsten, J. (2013) Six1 regulates proliferation of Pax7-positive muscle progenitors in zebrafish. Journal of Cell Science. 126(Pt 8):1868-80
- Shwartz, Y., Farkas, Z., Stern, T., Aszódi, A., and Zelzer, E. (2012) Muscle contraction controls skeletal morphogenesis through regulation of chondrocyte convergent extension. Developmental Biology. 370(1):154-163
- Burguière, A.C., Nord, H., and von Hofsten, J. (2011) Alkali-like myosin light chain-1 (myl1) is an early marker for differentiating fast muscle cells in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 240(7):1856-1863
- Hinits, Y., Williams, V.C., Sweetman, D., Donn, T.M., Ma, T.P., Moens, C.B., and Hughes, S.M. (2011) Defective cranial skeletal development, larval lethality and haploinsufficiency in Myod mutant zebrafish. Developmental Biology. 358(1):102-12
1 - 10 of 22
Show