CRISPR

CRISPR1-f2rl1.1

ID
ZDB-CRISPR-250909-1
Name
CRISPR1-f2rl1.1
Previous Names
None
Target
Sequence
5' - GGGTCGAGTGACATCATGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
lkc4 f2rl1.1
lkc5 f2rl1.1
lkc6 f2rl1.1
Expression
Gene expression in Wild Types + CRISPR1-f2rl1.1
No data available
Phenotype
Phenotype resulting from CRISPR1-f2rl1.1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-f2rl1.1
Phenotype Fish Conditions Figures
fertilized egg cytoplasmic streaming decreased occurrence, abnormal f2rl1.1lkc4/lkc4 standard conditions Fig 2 with image from Ma et al., 2025
egg activation absent process, abnormal f2rl1.1lkc4/lkc4 standard conditions Fig 2 with image,  Fig 4 with image from Ma et al., 2025
egg activation process quality, ameliorated f2rl1.1lkc4/lkc4 chemical treatment by environment: ionomycin Fig 4 with image from Ma et al., 2025
fertilized egg actin cytoskeleton distributed, abnormal f2rl1.1lkc4/lkc4 standard conditions Fig 2 with image from Ma et al., 2025
gastrulation absent process, abnormal f2rl1.1lkc4/lkc4 standard conditions Fig 4 with image from Ma et al., 2025
cortical granule exocytosis decreased occurrence, abnormal f2rl1.1lkc4/lkc4 standard conditions Fig 5 with image from Ma et al., 2025
multicellular organism development process quality, ameliorated f2rl1.1lkc4/lkc4 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 4 with image from Ma et al., 2025
cortical granule exocytosis occurrence, ameliorated f2rl1.1lkc4/lkc4 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 5 with image from Ma et al., 2025
whole organism necrotic, abnormal f2rl1.1lkc4/lkc4 standard conditions Fig 4 with image from Ma et al., 2025
fertilized egg cortical granule present, abnormal f2rl1.1lkc4/lkc4 standard conditions Fig 2 with image from Ma et al., 2025
gastrulation process quality, ameliorated f2rl1.1lkc4/lkc4 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 4 with image from Ma et al., 2025
fertilized egg calcium atom decreased amount, abnormal f2rl1.1lkc4/lkc4 standard conditions Fig 5 with image from Ma et al., 2025
fertilized egg calcium atom amount, ameliorated f2rl1.1lkc4/lkc4 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 5 with image from Ma et al., 2025
egg activation process quality, ameliorated f2rl1.1lkc4/lkc4 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 4 with image from Ma et al., 2025
egg activation absent process, abnormal f2rl1.1lkc6/lkc6 standard conditions Fig 2 with image,  Fig 4 with image from Ma et al., 2025
fertilized egg cytoplasmic streaming decreased occurrence, abnormal f2rl1.1lkc6/lkc6 standard conditions Fig 2 with image from Ma et al., 2025
egg activation process quality, ameliorated f2rl1.1lkc6/lkc6 chemical treatment by environment: ionomycin Fig 4 with image from Ma et al., 2025
fertilized egg actin cytoskeleton distributed, abnormal f2rl1.1lkc6/lkc6 standard conditions Fig 2 with image from Ma et al., 2025
gastrulation absent process, abnormal f2rl1.1lkc6/lkc6 standard conditions Fig 4 with image from Ma et al., 2025
cortical granule exocytosis decreased occurrence, abnormal f2rl1.1lkc6/lkc6 standard conditions Fig 5 with image from Ma et al., 2025
multicellular organism development process quality, ameliorated f2rl1.1lkc6/lkc6 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 4 with image from Ma et al., 2025
whole organism necrotic, abnormal f2rl1.1lkc6/lkc6 standard conditions Fig 4 with image from Ma et al., 2025
cortical granule exocytosis occurrence, ameliorated f2rl1.1lkc6/lkc6 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 5 with image from Ma et al., 2025
gastrulation process quality, ameliorated f2rl1.1lkc6/lkc6 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 4 with image from Ma et al., 2025
fertilized egg cortical granule present, abnormal f2rl1.1lkc6/lkc6 standard conditions Fig 2 with image from Ma et al., 2025
fertilized egg calcium atom amount, ameliorated f2rl1.1lkc6/lkc6 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 5 with image from Ma et al., 2025
fertilized egg calcium atom decreased amount, abnormal f2rl1.1lkc6/lkc6 standard conditions Fig 5 with image from Ma et al., 2025
egg activation process quality, ameliorated f2rl1.1lkc6/lkc6 chemical treatment by injection: 1D-myo-inositol 1,4,5-trisphosphate Fig 4 with image from Ma et al., 2025
fertilized egg calcium atom decreased amount, abnormal f2rl1.1lkc4/lkc4; lkc2Tg standard conditions Fig 3 with image from Ma et al., 2025
fertilized egg calcium atom decreased amount, abnormal f2rl1.1lkc6/lkc6; lkc2Tg standard conditions Fig 3 with image from Ma et al., 2025
egg activation absent process, abnormal f2rl1.1lkc5/lkc5; f2rl1.2lkc7/lkc7 standard conditions Fig. S1 from Ma et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.