Morpholino
MO1-gle1
- ID
- ZDB-MRPHLNO-120406-2
- Name
- MO1-gle1
- Previous Names
-
- drgle1ATG1 (1)
- Target
- Sequence
-
5' - TCAGAAGGCATTTTGAGGGCATTAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gle1
No data available
Phenotype
Phenotype resulting from MO1-gle1
No data available
Phenotype of all Fish created by or utilizing MO1-gle1
1 - 5 of 31 Show all
Citations
- Wolf, E.J., Miles, A., Lee, E.S., Nabeel-Shah, S., Greenblatt, J.F., Palazzo, A.F., Tropepe, V., Emili, A. (2020) MKRN2 Physically Interacts with GLE1 to Regulate mRNA Export and Zebrafish Retinal Development. Cell Reports. 31:107693
- Jao, L.E., Akef, A., Wente, S.R. (2017) A role for Gle1, a regulator of DEAD-box RNA helicases, at centrosomes and basal bodies. Molecular biology of the cell. 28:120-127
- Kaneb, H.M., Folkmann, A.W., Belzil, V.V., Jao, L.E., Leblond, C.S., Girard, S.L., Daoud, H., Noreau, A., Rochefort, D., Hince, P., Szuto, A., Levert, A., Vidal, S., André-Guimont, C., Camu, W., Bouchard, J.P., Dupré, N., Rouleau, G.A., Wente, S.R., Dion, P.A. (2015) Deleterious mutations in the essential mRNA metabolism factor, hGle1, in Amyotrophic Lateral Sclerosis. Human molecular genetics. 24(5):1363-73
- Jao, L.E., Appel, B., and Wente, S.R. (2012) A zebrafish model of lethal congenital contracture syndrome 1 reveals Gle1 function in spinal neural precursor survival and motor axon arborization. Development (Cambridge, England). 139(7):1316-1326
1 - 4 of 4
Show