Morpholino

MO2-pak1

ID
ZDB-MRPHLNO-100507-2
Name
MO2-pak1
Previous Names
None
Target
Sequence
5' - GCATCACTCACTCTTGTCTCCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pak1
No data available
Phenotype
Phenotype resulting from MO2-pak1
Phenotype Fish Figures
atrium morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
blood accumulation heart, abnormal sd2Tg + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
blood circulation decreased process quality, abnormal WT + MO2-pak1 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Kelly et al., 2014
bulbus arteriosus morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
bulbus arteriosus development process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
ceratohyal cartilage morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
head decreased size, abnormal WT + MO2-pak1 Fig. 3 with image,  Fig. 4 with image from Kelly et al., 2014
head cell death increased process quality, abnormal WT + MO2-pak1 Fig. 1 with image from Kelly et al., 2014
heart morphology, abnormal WT + MO2-pak1 Fig. 1 with image from Kelly et al., 2014
heart looping decreased process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
Meckel's cartilage morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
melanocyte decreased amount, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
melanocyte neural crest cell migration process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
neural crest cell migration process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
pericardium edematous, abnormal WT + MO2-pak1 Fig. 1 with image,  Fig. 3 with image from Kelly et al., 2014
pharyngeal arch morphology, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
pigmentation decreased process quality, abnormal WT + MO2-pak1 Fig. 2 with image from Kelly et al., 2014
whole organism curved, abnormal WT + MO2-pak1 Fig. 1 with image,  Fig. 3 with image,  Fig. 4 with image from Kelly et al., 2014
whole organism lacks parts or has fewer parts of type portion of tissue, abnormal WT + MO2-pak1 Fig. 1 with image from Kelly et al., 2014
Phenotype of all Fish created by or utilizing MO2-pak1
Phenotype Fish Conditions Figures
atrium morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
blood circulation decreased process quality, abnormal WT + MO2-pak1 standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 4 with image from Kelly et al., 2014
whole organism curved, abnormal WT + MO2-pak1 standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 4 with image from Kelly et al., 2014
pharyngeal arch morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
neural crest cell migration process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
heart looping decreased process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
whole organism lacks parts or has fewer parts of type portion of tissue, abnormal WT + MO2-pak1 standard conditions Fig. 1 with image from Kelly et al., 2014
pericardium edematous, abnormal WT + MO2-pak1 standard conditions Fig. 1 with image,  Fig. 3 with image from Kelly et al., 2014
head cell death increased process quality, abnormal WT + MO2-pak1 standard conditions Fig. 1 with image from Kelly et al., 2014
heart morphology, abnormal WT + MO2-pak1 standard conditions Fig. 1 with image from Kelly et al., 2014
pigmentation decreased process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
head decreased size, abnormal WT + MO2-pak1 standard conditions Fig. 3 with image,  Fig. 4 with image from Kelly et al., 2014
bulbus arteriosus development process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
ceratohyal cartilage morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
melanocyte decreased amount, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
Meckel's cartilage morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
melanocyte neural crest cell migration process quality, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
bulbus arteriosus morphology, abnormal WT + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
blood circulation decreased process quality, abnormal sd2Tg + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
blood accumulation heart, abnormal sd2Tg + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
heart looping decreased process quality, abnormal twu34Tg + MO2-pak1 standard conditions Fig. 2 with image from Kelly et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.