Morpholino
MO3-bmp4
- ID
- ZDB-MRPHLNO-070710-1
- Name
- MO3-bmp4
- Previous Names
- None
- Target
- Sequence
-
5' - GGTGTTTGATTGTCTGACCTTCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
e1-e2 splice blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bmp4
No data available
Phenotype
Phenotype resulting from MO3-bmp4
1 - 5 of 14 Show all
Phenotype of all Fish created by or utilizing MO3-bmp4
1 - 5 of 27 Show all
Citations
- Rago, L., Castroviejo, N., Fazilaty, H., Garcia-Asencio, F., Ocaña, O.H., Galcerán, J., Nieto, M.A. (2019) MicroRNAs Establish the Right-Handed Dominance of the Heart Laterality Pathway in Vertebrates. Developmental Cell. 51:446-459.e5
- Grassini, D.R., Lagendijk, A.K., De Angelis, J.E., Da Silva, J., Jeanes, A., Zettler, N., Bower, N.I., Hogan, B.M., Smith, K.A. (2018) Nppa and Nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume. Development (Cambridge, England). 145(12)
- Monteiro, R., Pinheiro, P., Joseph, N., Peterkin, T., Koth, J., Repapi, E., Bonkhofer, F., Kirmizitas, A., Patient, R. (2016) Transforming Growth Factor β Drives Hemogenic Endothelium Programming and the Transition to Hematopoietic Stem Cells. Developmental Cell. 38(4):358-70
- Gu, W., Monteiro, R., Zuo, J., Simões, F.C., Martella, A., Andrieu-Soler, C., Grosveld, F., Sauka-Spengler, T., Patient, R. (2015) A Novel TGFβ Modulator that Uncouples R-Smad/I-Smad-Mediated Negative Feedback from R-Smad/Ligand-Driven Positive Feedback. PLoS Biology. 13:e1002051
- Lenhart, K.F., Holtzman, N.G., Williams, J.R., and Burdine, R.D. (2013) Integration of Nodal and BMP Signals in the Heart Requires FoxH1 to Create Left-Right Differences in Cell Migration Rates That Direct Cardiac Asymmetry. PLoS Genetics. 9(1):e1003109
- Ramel, M.C., and Hill, C.S. (2013) The ventral to dorsal BMP activity gradient in the early zebrafish embryo is determined by graded expression of BMP ligands. Developmental Biology. 378(2):170-82
- Huang, S., Ma, J., Liu, X., Zhang, Y., and Luo, L. (2011) Retinoic acid signaling sequentially controls visceral and heart laterality in Zebrafish. The Journal of biological chemistry. 286(32):28533-43
- Smith, K.A., Lagendijk, A.K., Courtney, A.D., Chen, H., Paterson, S., Hogan, B.M., Wicking, C., and Bakkers, J. (2011) Transmembrane protein 2 (Tmem2) is required to regionally restrict atrioventricular canal boundary and endocardial cushion development. Development (Cambridge, England). 138(19):4193-4198
- French, C.R., Erickson, T., French, D.V., Pilgrim, D.B., and Waskiewicz, A.J. (2009) Gdf6a is required for the initiation of dorsal-ventral retinal patterning and lens development. Developmental Biology. 333(1):37-47
- Wilkinson, R.N., Pouget, C., Gering, M., Russell, A.J., Davies, S.G., Kimelman, D., and Patient, R. (2009) Hedgehog and Bmp polarize hematopoietic stem cell emergence in the zebrafish dorsal aorta. Developmental Cell. 16(6):909-916
1 - 10 of 13
Show