Morpholino
MO1-lamb1a
- ID
- ZDB-MRPHLNO-060916-1
- Name
- MO1-lamb1a
- Previous Names
-
- MO1-lamb1
- Target
- Sequence
-
5' - TATTTCCAGTTTCTTTCTTCAGCGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lamb1a
No data available
Phenotype
Phenotype resulting from MO1-lamb1a
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-lamb1a
1 - 5 of 17 Show all
Citations
- Hu, B., Gao, Y., Davies, L., Woo, S., Topczewski, J., Jessen, J.R., Lin, F. (2018) Glypican 4 and Mmp14 interact in regulating the migration of anterior endodermal cells by limiting extracellular matrix deposition. Development (Cambridge, England). 145(17):
- Goody, M.F., Kelly, M.W., Lessard, K.N., Khalil, A., and Henry, C.A. (2010) Nrk2b-mediated NAD+ production regulates cell adhesion and is required for muscle morphogenesis in vivo: Nrk2b and NAD+ in muscle morphogenesis. Developmental Biology. 344(2):809-826
- Snow, C.J., Goody, M., Kelly, M.W., Oster, E.C., Jones, R., Khalil, A., and Henry, C.A. (2008) Time-lapse analysis and mathematical characterization elucidate novel mechanisms underlying muscle morphogenesis. PLoS Genetics. 4(10):e1000219
- Parsons, M.J., Pollard, S.M., Saude, L., Feldman, B., Coutinho, P., Hirst, E.M., and Stemple, D.L. (2002) Zebrafish mutants identify an essential role for laminins in notochord formation. Development (Cambridge, England). 129(13):3137-3146
1 - 4 of 4
Show