Morpholino
MO2-notch1b
- ID
- ZDB-MRPHLNO-060320-1
- Name
- MO2-notch1b
- Previous Names
-
- Notch 1b exon 27 donor (1)
- Target
- Sequence
-
5' - AATCTCAAACTGACCTCAAACCGAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-notch1b
No data available
Phenotype
Phenotype resulting from MO2-notch1b
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO2-notch1b
1 - 5 of 26 Show all
Citations
- Lin, Y., Yang, Q., Lin, X., Liu, X., Qian, Y., Xu, D., Cao, N., Han, X., Zhu, Y., Hu, W., He, X., Yu, Z., Kong, X., Zhu, L., Zhong, Z., Liu, K., Zhou, B., Wang, Y., Peng, J., Zhu, W., Wang, J. (2023) Extracellular Matrix Disorganization Caused by ADAMTS16 Deficiency Leads to Bicuspid Aortic Valve With Raphe Formation. Circulation. 149(8):605-626
- Ando, K., Wang, W., Peng, D., Chiba, A., Lagendijk, A., Barske, L., Crump, J.G., Stainier, D.Y.R., Lendahl, U., Koltowska, K., Hogan, B.M., Fukuhara, S., Mochizuki, N., Betsholtz, C. (2019) Peri-arterial specification of vascular mural cells from naïve mesenchyme requires Notch signaling. Development (Cambridge, England). 146(2):
- Chen, X., Gays, D., Milia, C., Santoro, M.M. (2017) Cilia Control Vascular Mural Cell Recruitment in Vertebrates. Cell Reports. 18:1033-1047
- Chiang, I.K., Fritzsche, M., Pichol-Thievend, C., Neal, A., Holmes, K., Lagendijk, A., Overman, J., D'Angelo, D., Omini, A., Hermkens, D., Lesieur, E., Liu, K., Ratnayaka, I., Corada, M., Bou-Gharios, G., Carroll, J., Dejana, E., Schulte-Merker, S., Hogan, B., Beltrame, M., De Val, S., Francois, M. (2017) SoxF factors induce Notch1 expression via direct transcriptional regulation during early arterial development. Development (Cambridge, England). 144(14):2629-2639
- Samsa, L.A., Givens, C., Tzima, E., Stainier, D.Y., Qian, L., Liu, J. (2015) Cardiac contraction activates endocardial Notch signaling to modulate chamber maturation in zebrafish. Development (Cambridge, England). 142:4080-91
- Yokota, Y., Nakajima, H., Wakayama, Y., Muto, A., Kawakami, K., Fukuhara, S., Mochizuki, N. (2015) Endothelial Ca(2+) oscillations reflect VEGFR signaling-regulated angiogenic capacity in vivo. eLIFE. 4
- Zhou, Y., Ge, R., Wang, R., Liu, F., Huang, Y., Liu, H., Hao, Y., Zhou, Q., Wang, C. (2015) UXT potentiates angiogenesis by attenuating Notch signaling. Development (Cambridge, England). 142(4):774-86
- Okigawa, S., Mizoguchi, T., Okano, M., Tanaka, H., Isoda, M., Jiang, Y.J., Suster, M., Higashijima, S.I., Kawakami, K., Itoh, M. (2014) Different combinations of Notch ligands and receptors regulate V2 interneuron progenitor proliferation and V2a/V2b cell fate determination. Developmental Biology. 391(2):196-206
- Alunni, A., Krecsmarik, M., Bosco, A., Galant, S., Pan, L., Moens, C.B., and Bally-Cuif, L. (2013) Notch3 signaling gates cell cycle entry and limits neural stem cell amplification in the adult pallium. Development (Cambridge, England). 140(16):3335-47
- Da'as, S.I., Coombs, A.J., Balci, T.B., Grondin, C.A., Ferrando, A.A., and Berman, J.N. (2012) The zebrafish reveals dependence of the mast cell lineage on Notch signaling in vivo. Blood. 119(15):3585-3594
1 - 10 of 14
Show