Morpholino
MO1-lama1
- ID
- ZDB-MRPHLNO-060119-1
- Name
- MO1-lama1
- Previous Names
-
- lama1 MO1 (1)
- Target
- Sequence
-
5' - ATCTCCATCATCGCTCAAACTAAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lama1
No data available
Phenotype
Phenotype resulting from MO1-lama1
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-lama1
1 - 5 of 19 Show all
Citations
- Sztal, T.E., Sonntag, C., Hall, T.E., and Currie, P.D. (2012) Epistatic dissection of laminin-receptor interactions in dystrophic zebrafish muscle. Human molecular genetics. 21(21):4718-4731
- Grant, P.K., and Moens, C.B. (2010) The neuroepithelial basement membrane serves as a boundary and a substrate for neuron migration in the zebrafish hindbrain. Neural Development. 5:9
- Sittaramane, V., Sawant, A., Wolman, M.A., Maves, L., Halloran, M.C., and Chandrasekhar, A. (2009) The cell adhesion molecule Tag1, transmembrane protein Stbm/Vangl2, and Lamininalpha1 exhibit genetic interactions during migration of facial branchiomotor neurons in zebrafish. Developmental Biology. 325(2):363-373
- Pollard, S.M., Parsons, M.J., Kamei, M., Kettleborough, R.N., Thomas, K.A., Pham, V.N., Bae, M.K., Scott, A., Weinstein, B.M., and Stemple, D.L. (2006) Essential and overlapping roles for laminin alpha chains in notochord and blood vessel formation. Developmental Biology. 289(1):64-76
1 - 4 of 4
Show