Morpholino
MO2-sox32
- ID
- ZDB-MRPHLNO-051216-6
- Name
- MO2-sox32
- Previous Names
-
- sox32 ATG (1)
- Target
- Sequence
-
5' - CAGGGAGCATCCGGTCGAGATACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sox32
No data available
Phenotype
Phenotype resulting from MO2-sox32
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO2-sox32
1 - 5 of 28 Show all
Citations
- Escot, S., Hassanein, Y., Elouin, A., Torres-Paz, J., Mellottee, L., Ignace, A., David, N.B. (2025) Nance-Horan-syndrome-like 1b controls mesodermal cell migration by regulating protrusion and actin dynamics during zebrafish gastrulation. Communications biology. 8:328328
- Westerich, K.J., Reinecke, S., Emich, J., Wyrwoll, M.J., Stallmeyer, B., Meyer, M., Oud, M.S., Fietz, D., Pilatz, A., Kliesch, S., Reichman-Fried, M., Tarbashevich, K., Limon, T., Stehling, M., Friedrich, C., Tüttelmann, F., Raz, E. (2023) Linking human Dead end 1 (DND1) variants to male infertility employing zebrafish embryos. Human reproduction (Oxford, England). 38(4):655-670
- Boutillon, A., Escot, S., Elouin, A., Jahn, D., González-Tirado, S., Starruß, J., Brusch, L., David, N.B. (2022) Guidance by followers ensures long-range coordination of cell migration through α-catenin mechanoperception. Developmental Cell. 57(12):1529-1544.e5
- Truszkowski, L., Batur, D., Long, H., Tarbashevich, K., Vos, B.E., Trappmann, B., Raz, E. (2022) Primordial germ cells adjust their protrusion type while migrating in different tissue contexts in vivo. Development (Cambridge, England). 150(2):
- Djenoune, L., Tomar, R., Dorison, A., Ghobrial, I., Schenk, H., Hegermann, J., Beverly-Staggs, L., Hidalgo-Gonzalez, A., Little, M.H., Drummond, I.A. (2021) Autonomous Calcium Signaling in Human and Zebrafish Podocytes Controls Kidney Filtration Barrier Morphogenesis. Journal of the American Society of Nephrology : JASN. 32(7):1697-1712
- Hu, B., Rodriguez, J.J., Kakkerla Balaraju, A., Gao, Y., Nguyen, N.T., Steen, H., Suhaib, S., Chen, S., Lin, F. (2021) Glypican 4 mediates Wnt transport between germ layers via signaling filopodia. The Journal of cell biology. 220(12):
- Mao, A., Zhang, M., Li, L., Liu, J., Ning, G., Cao, Y., Wang, Q. (2020) Pharyngeal pouches provide a niche microenvironment for arch artery progenitor specification. Development (Cambridge, England). 148(2):
- Li, L., Ning, G., Yang, S., Yan, Y., Cao, Y., Wang, Q. (2019) BMP signaling is required for nkx2.3-positive pharyngeal pouch progenitor specification in zebrafish. PLoS Genetics. 15:e1007996
- Mao, A., Zhang, M., Liu, J., Cao, Y., Wang, Q. (2019) PDGF signaling from pharyngeal pouches promotes arch artery morphogenesis. Journal of genetics and genomics = Yi chuan xue bao. 46(12):551-559
- Li, L., Mao, A., Wang, P., Ning, G., Cao, Y., Wang, Q. (2018) Endodermal pouch-expressed dmrt2b is important for pharyngeal cartilage formation.. Biology Open. 7(12):
1 - 10 of 29
Show