Morpholino
MO3-cxcl12a
- ID
- ZDB-MRPHLNO-051028-2
- Name
- MO3-cxcl12a
- Previous Names
-
- SDF-1a-1-MO (1)
- Target
- Sequence
-
5' - CTACTACGATCACTTTGAGATCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cxcl12a
No data available
Phenotype
Phenotype resulting from MO3-cxcl12a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO3-cxcl12a
1 - 5 of 21 Show all
Citations
- Theodore, L.N., Hagedorn, E.J., Cortes, M., Natsuhara, K., Liu, S.Y., Perlin, J.R., Yang, S., Daily, M.L., Zon, L.I., North, T.E. (2017) Distinct Roles for Matrix Metalloproteinases 2 and 9 in Embryonic Hematopoietic Stem Cell Emergence, Migration, and Niche Colonization. Stem Cell Reports. 8(5):1226-1241
- Donà, E., Barry, J.D., Valentin, G., Quirin, C., Khmelinskii, A., Kunze, A., Durdu, S., Newton, L.R., Fernandez-Minan, A., Huber, W., Knop, M., and Gilmour, D. (2013) Directional tissue migration through a self-generated chemokine gradient. Nature. 503(7475):285-9
- Lewellis, S.W., Nagelberg, D., Subedi, A., Staton, A., Leblanc, M., Giraldez, A., and Knaut, H. (2013) Precise SDF1-mediated cell guidance is achieved through ligand clearance and microRNA-mediated decay. The Journal of cell biology. 200(3):337-355
- Hess, I., and Boehm, T. (2012) Intravital Imaging of Thymopoiesis Reveals Dynamic Lympho-Epithelial Interactions. Immunity. 36(2):298-309
- Zhang, Y., Jin, H., Li, L., Qin, F.X., and Wen, Z. (2011) cMyb regulates hematopoietic stem/progenitor cell mobilization during zebrafish hematopoiesis. Blood. 118(15):4093-101
- Bajoghli, B., Aghaallaei, N., Hess, I., Rode, I., Netuschil, N., Tay, B.H., Venkatesh, B., Yu, J.K., Kaltenbach, S.L., Holland, N.D., Diekhoff, D., Happe, C., Schorpp, M., and Boehm, T. (2009) Evolution of genetic networks underlying the emergence of thymopoiesis in vertebrates. Cell. 138(1):186-197
- Mich, J.K., Blaser, H., Thomas, N.A., Firestone, A.J., Yelon, D., Raz, E., and Chen, J.K. (2009) Germ cell migration in zebrafish is cyclopamine-sensitive but Smoothened-independent. Developmental Biology. 328(2):342-354
- Boldajipour, B., Mahabaleshwar, H., Kardash, E., Reichman-Fried, M., Blaser, H., Minina, S., Wilson, D., Xu, Q., and Raz, E. (2008) Control of chemokine-guided cell migration by ligand sequestration. Cell. 132(3):463-473
- Mizoguchi, T., Verkade, H., Heath, J.K., Kuroiwa, A., and Kikuchi, Y. (2008) Sdf1/Cxcr4 signaling controls the dorsal migration of endodermal cells during zebrafish gastrulation. Development (Cambridge, England). 135(15):2521-2529
- Blaser, H., Reichman-Fried, M., Castanon, I., Dumstrei, K., Marlow, F.L., Kawakami, K., Solnica-Krezel, L., Heisenberg, C.P., and Raz, E. (2006) Migration of zebrafish primordial germ cells: a role for Myosin contraction and cytoplasmic flow. Developmental Cell. 11(5):613-627
1 - 10 of 12
Show