Morpholino
MO1-dnmt3bb.2
- ID
- ZDB-MRPHLNO-050809-5
- Name
- MO1-dnmt3bb.2
- Previous Names
-
- dnmt3-MO (1)
- Target
- Sequence
-
5' - CTCCGATCTTTACATCTGCCACCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnmt3bb.2
No data available
Phenotype
Phenotype resulting from MO1-dnmt3bb.2
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO1-dnmt3bb.2
1 - 5 of 16 Show all
Citations
- Fillatre, J., Fauny, J.D., Fels, J.A., Li, C., Goll, M., Thisse, C., Thisse, B. (2019) TEADs, Yap, Taz, Vgll4s transcription factors control the establishment of Left-Right asymmetry in Zebrafish. eLIFE. 8:
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
- Rai, K., Jafri, I.F., Chidester, S., James, S.R., Karpf, A.R., Cairns, B.R., and Jones, D.A. (2010) Dnmt3 and G9a cooperate for tissue-specific development in zebrafish. The Journal of biological chemistry. 285(6):4110-4121
- Shimoda, N., Yamakoshi, K., Miyake, A., and Takeda, H. (2005) Identification of a gene required for de novo DNA methylation of the zebrafish no tail gene. Developmental Dynamics : an official publication of the American Association of Anatomists. 233(4):1509-1516
1 - 4 of 4
Show