Morpholino
MO2-sp5l
- ID
- ZDB-MRPHLNO-050607-2
- Name
- MO2-sp5l
- Previous Names
-
- spr2-MO2 (1)
- Target
- Sequence
-
5' - CCCCCTTACACAGCCAGGTGCGTAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sp5l
No data available
Phenotype
Phenotype resulting from MO2-sp5l
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-sp5l
1 - 5 of 28 Show all
Citations
- Tan, A.L., Mohanty, S., Guo, J., Lekven, A.C., Riley, B.B. (2022) Pax2a, Sp5a and Sp5l act downstream of Fgf and Wnt to coordinate sensory-neural patterning in the inner ear. Developmental Biology. 492:139-153
- Labalette, C., Wassef, M.A., Desmarquet-Trin Dinh, C., Bouchoucha, Y.X., Le Men, J., Charnay, P., Gilardi-Hebenstreit, P. (2015) Molecular dissection of segment formation in the developing hindbrain. Development (Cambridge, England). 142:185-95
- Sun, Z., Zhao, J., Zhang, Y., and Meng, A. (2006) Sp5l is a mediator of Fgf signals in anteroposterior patterning of the neuroectoderm in zebrafish embryo. Developmental Dynamics : an official publication of the American Association of Anatomists. 235(11):2999-3006
- Thorpe, C.J., Weidinger, G., and Moon, R.T. (2005) Wnt/β-catenin regulation of the Sp1-related transcription factor sp5l promotes tail development in zebrafish. Development (Cambridge, England). 132(8):1763-1772
- Weidinger, G., Thorpe, C.J., Wuennenberg-Stapleton, K., Ngai, J., and Moon, R.T. (2005) The Sp1-Related Transcription Factors sp5 and sp5-like Act Downstream of Wnt/beta-Catenin Signaling in Mesoderm and Neuroectoderm Patterning. Current biology : CB. 15(6):489-500
- Zhao, J., Cao, Y., Zhao, C., Postlethwait, J., and Meng, A. (2003) An SP1-like transcription factor Spr2 acts downstream of Fgf signaling to mediate mesoderm induction. The EMBO journal. 22(22):6078-6088
1 - 6 of 6
Show