Morpholino
MO1-epha4a
- ID
- ZDB-MRPHLNO-050522-1
- Name
- MO1-epha4a
- Previous Names
-
- EphA4TB (1)
- Target
- Sequence
-
5' - AACACAAGCGCAGCCATTGGTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocker.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-epha4a
No data available
Phenotype
Phenotype resulting from MO1-epha4a
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO1-epha4a
1 - 5 of 37 Show all
Citations
- Addison, M., Xu, Q., Cayuso, J., Wilkinson, D.G. (2018) Cell Identity Switching Regulated by Retinoic Acid Signaling Maintains Homogeneous Segments in the Hindbrain. Developmental Cell. 45:606-620.e3
- Letelier, J., Terriente, J., Belzunce, I., Voltes, A., Undurraga, C.A., Polvillo, R., Devos, L., Tena, J.J., Maeso, I., Retaux, S., Gomez-Skarmeta, J.L., Martínez-Morales, J.R., Pujades, C. (2018) Evolutionary emergence of the rac3b/rfng/sgca regulatory cluster refined mechanisms for hindbrain boundaries formation.. Proceedings of the National Academy of Sciences of the United States of America. 115(16):E3731-E3740
- Royet, A., Broutier, L., Coissieux, M.M., Malleval, C., Gadot, N., Maillet, D., Gratadou-Hupon, L., Bernet, A., Nony, P., Treilleux, I., Honnorat, J., Liebl, D., Pelletier, L., Berger, F., Meyronet, D., Castets, M., Mehlen, P. (2017) Ephrin-B3 supports glioblastoma growth by inhibiting apoptosis induced by the dependence receptor EphA4. Oncotarget. 8:23750-23759
- Cavodeassi, F., Ivanovitch, K., and Wilson, S.W. (2013) Eph/Ephrin signalling maintains eye field segregation from adjacent neural plate territories during forebrain morphogenesis. Development (Cambridge, England). 140(20):4193-4202
- Terriente, J., Gerety, S.S., Watanabe-Asaka, T., Gonzalez-Quevedo, R., and Wilkinson, D.G. (2012) Signalling from hindbrain boundaries regulates neuronal clustering that patterns neurogenesis. Development (Cambridge, England). 139(16):2978-2987
- Jülich, D., Mould, A.P., Koper, E., and Holley, S.A. (2009) Control of extracellular matrix assembly along tissue boundaries via Integrin and Eph/Ephrin signaling. Development (Cambridge, England). 136(17):2913-2921
- Kemp, H.A., Cooke, J.E., and Moens, C.B. (2009) EphA4 and EfnB2a maintain rhombomere coherence by independently regulating intercalation of progenitor cells in the zebrafish neural keel. Developmental Biology. 327(2):313-326
- Cooke, J.E., Kemp, H.A., and Moens, C.B. (2005) EphA4 Is Required for Cell Adhesion and Rhombomere-Boundary Formation in the Zebrafish. Current biology : CB. 15(6):536-542
1 - 8 of 8
Show