Morpholino
MO1-notch2
- ID
- ZDB-MRPHLNO-041207-6
- Name
- MO1-notch2
- Previous Names
-
- MO-notch2-1 (1)
- Target
- Sequence
-
5' - AGGTGAACACTTACTTCATGCCAAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
designed to bind to exon-intron region, predicted to generate a premature stop codon after the last exon 7 codon, thus deleting the entire ankyrin repeat domain.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-notch2
No data available
Phenotype
Phenotype resulting from MO1-notch2
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO1-notch2
1 - 5 of 23 Show all
Citations
- Xia, Z., Bi, X., Yang, S., Yang, X., Song, Z., Wei, J., Xu, P., Rink, L., Min, J., Wang, F. (2021) Metal transporter Slc30a1 controls pharyngeal neural crest differentiation via the zinc-Snai2-Jag1 cascade. MedComm. 2:778-797
- Campbell, L.J., Hobgood, J.S., Jia, M., Boyd, P., Hipp, R.I., Hyde, D.R. (2020) Notch3 and DeltaB maintain Müller glia quiescence and act as negative regulators of regeneration in the light-damaged zebrafish retina. Glia. 69(3):546-566
- O'Hare, E.A., Yerges-Armstrong, L.M., Perry, J.A., Shuldiner, A.R., Zaghloul, N.A. (2016) Assignment of Functional Relevance to Genes at Type 2 Diabetes-Associated Loci Through Investigation of β-Cell Mass Deficits. Molecular endocrinology (Baltimore, Md.). 30(4):429-45
- Da'as, S.I., Coombs, A.J., Balci, T.B., Grondin, C.A., Ferrando, A.A., and Berman, J.N. (2012) The zebrafish reveals dependence of the mast cell lineage on Notch signaling in vivo. Blood. 119(15):3585-3594
- Geudens, I., Herpers, R., Hermans, K., Segura, I., Ruiz de Almodovar, C., Bussmann, J., De Smet, F., Vandevelde, W., Hogan, B.M., Siekmann, A., Claes, F., Moore, J.C., Pistocchi, A.S., Loges, S., Mazzone, M., Mariggi, G., Bruyere, F., Cotelli, F., Kerjaschki, D., Noel, A., Foidart, J.M., Gerhardt, H., Ny, A., Langenberg, T., Lawson, N.D., Duckers, H.J., Schulte-Merker, S., Carmeliet, P., and Dewerchin, M. (2010) Role of delta-like-4/Notch in the formation and wiring of the lymphatic network in zebrafish. Arterioscler. Thromb. Vasc. Biol.. 30(9):1695-1702
- Zuniga, E., Stellabotte, F., and Crump, J.G. (2010) Jagged-Notch signaling ensures dorsal skeletal identity in the vertebrate face. Development (Cambridge, England). 137(11):1843-1852
- Bill, B.R., Balciunas, D., McCarra, J.A., Young, E.D., Xiong, T., Spahn, A.M., Garcia-Lecea, M., Korzh, V., Ekker, S.C., and Schimmenti, L.A. (2008) Development and notch signaling requirements of the zebrafish choroid plexus. PLoS One. 3(9):e3114
- Hsiao, C.D., You, M.S., Guh, Y.J., Ma, M., Jiang, Y.J., and Hwang, P.P. (2007) A Positive Regulatory Loop between foxi3a and foxi3b Is Essential for Specification and Differentiation of Zebrafish Epidermal Ionocytes. PLoS One. 2(1):e302
- Leslie, J.D., Ariza-McNaughton, L., Bermange, A.L., McAdow, R., Johnson, S.L., and Lewis, J. (2007) Endothelial signalling by the Notch ligand Delta-like 4 restricts angiogenesis. Development (Cambridge, England). 134(5):839-844
- Lorent, K., Yeo, S.Y., Oda, T., Chandrasekharappa, S., Chitnis, A., Matthews, R.P., and Pack, M. (2004) Inhibition of Jagged-mediated Notch signaling disrupts zebrafish biliary development and generates multi-organ defects compatible with an Alagille syndrome phenocopy. Development (Cambridge, England). 131(22):5753-5766
1 - 10 of 10
Show