Morpholino Name: | MO3-plcg1 | ||||||
---|---|---|---|---|---|---|---|
Target: | plcg1 (1) | ||||||
Previous Name: | MO4-plcg1 | ||||||
Add new Alias
Delete Alias:(Including Attributions) |
|||||||
Sequence: |
5' - ATTAGCATAGGGAACTTACTTTCG - 3'
|
||||||
(Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.) | |||||||
Note: | This morpholino sequence is based on sequence of the intron-exon boundaries of the plcg1 gene in the Tg(fli1:EGFP)y1 (EK) line. The mismatch with Ensembl builds (Zv5, Zv8) may reflect a polymorphism. |