ZFIN ID: ZDB-GENE-980526-166

Mapping Details

Gene Name: sonic hedgehog signaling molecule a
Symbol: shha
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN JBrowse 7 40,884,012 - 40,893,295 GRCz11
Ensembl 7 40,884,012 - 40,893,295 GRCz11
Vega 7 40,603,939 - 40,613,222 GRCv10
NCBI Map Viewer 7 40,884,012 - 40,891,326 GRCz11
UCSC 7 - GRCz11
Mapped Clones containing shha
CH211-105D1 Chr: 7 Details
CH211-150E22 Chr: 7 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
bo5Tg 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
hg125 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
hg126 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
shha_unspecified 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
tbq70 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
tbx392 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
tq252 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11
vcc8Gt 7 GRCz11
7 GRCz11
7 GRCz11
7 GRCz11

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 111.6 cM shh Mother of Pearl (MOP) Postlethwait, John H. Data
7 165.63 cR shh Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
7 4073.0 cR shh Goodfellow T51 (T51) Geisler, Robert Data
7 86.7 cM shh Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
en2a GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
ccne1 GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
isl2b GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
foxb1b GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z1059 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z1182 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z3445 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z4706 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
ache GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.

OTHER MAPPING INFORMATION
Chr 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP  ...
Markers Encoded by shha
fc83d08 Chr: 7 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 369 MnlI 36.0
Forward Primer ACACACACACGGAGTCGAAT
Reverse Primer AAAGAAACAGCTCAAGACTGCA
Genomic Feature vcc8Gt is an allele of shha