ZFIN ID: ZDB-GENE-980526-485

Mapping Details

Gene Name: POU domain, class 5, transcription factor 3
Symbol: pou5f3
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN JBrowse 21 13,685,853 - 13,690,712 GRCz11
Ensembl 21 13,685,853 - 13,690,712 GRCz11
Vega 21 13,589,124 - 13,593,983 GRCv10
NCBI Map Viewer 21 13,685,853 - 13,690,719 GRCz11
UCSC 21 - GRCz11
Mapped Clones containing pou5f3
CH73-205E12 Chr: 21 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
e713 21 13,687,101 GRCz11 Burgess et al., 2002
hi349Tg 21 13,689,438 - 13,689,439 GRCz11 ZFIN Curated Data
hi1757Tg 21 13,692,718 - 13,692,719 GRCz11 ZFIN Curated Data
hi1940Tg 21 13,690,021 - 13,690,022 GRCz11 ZFIN Curated Data
ihb137 21 13,689,976 - 13,689,979 GRCz11 Zhang et al., 2020
ihb893 21 13,689,972 - 13,689,976 GRCz11 Wang et al., 2023
ihb934 21 13,689,975 - 13,689,981 GRCz11 Zebrafish Nomenclature Committee
ihb935 21 13,689,956 - 13,689,980 GRCz11 Zebrafish Nomenclature Committee
m216 21 13,687,101 GRCz11 Belting et al., 2001
sa1294 21 13,687,075 GRCz11 Busch-Nentwich et al., 2013
21 13,590,346 GRCz10 Busch-Nentwich et al., 2013
21 11,889,172 Zv9 Busch-Nentwich et al., 2013
sa1329 21 13,690,432 GRCz11 Busch-Nentwich et al., 2013
21 13,593,703 GRCz10 Busch-Nentwich et al., 2013
21 11,892,529 Zv9 Busch-Nentwich et al., 2013
sud25 21 13,690,395 - 13,690,401 GRCz11 Yuikawa et al., 2023
la013973Tg 21 11,890,655 - 11,890,665 Zv9
e713 21 GRCz11
m793 21 GRCz11
e68 21 GRCz11
21 GRCz11
21 GRCz11
e713 21 GRCz11
21 GRCz11
21 GRCz11
21 GRCz11
21 GRCz11
hi349Tg 21 GRCz11
21 GRCz11
21 GRCz11
hi1757Tg 21 GRCz11
21 GRCz11
21 GRCz11
hi1940Tg 21 GRCz11
21 GRCz11
21 GRCz11
ihb137 21 GRCz11
21 GRCz11
21 GRCz11
ihb138 21 GRCz11
21 GRCz11
21 GRCz11
ihb893 21 GRCz11
21 GRCz11
21 GRCz11
la013973Tg 21 GRCz11
21 GRCz11
21 GRCz11
m216 21 GRCz11
21 GRCz11
21 GRCz11
m308 21 GRCz11
21 GRCz11
21 GRCz11
m793 21 GRCz11
21 GRCz11
21 GRCz11
21 GRCz11
21 GRCz11
pou5f3_unspecified 21 GRCz11
21 GRCz11
21 GRCz11
sa1294 21 GRCz11
21 GRCz11
21 GRCz11
sa1329 21 GRCz11
21 GRCz11
21 GRCz11
sud25 21 GRCz11
21 GRCz11
21 GRCz11
wi270Tg 21 GRCz11
21 GRCz11
21 GRCz11
zf3267 21 GRCz11
21 GRCz11
21 GRCz11

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
21 57.8 cM pou2 Mother of Pearl (MOP) Postlethwait, John H. Data
21 1331.0 cR pou2 Goodfellow T51 (T51) Geisler, Robert Data
21 50.3 cM pou2 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by pou5f3
chunp6868 Chr: 21 Details
fd18d06 Chr: 21 Details
Genomic Feature m793 is an allele of pou5f3
Marker Type Chr Distance Publication / Person Comments
z21718 SSLP 21 Belting et al., 2001 Using a panel of 2418 spgm793/spgm793 embryos, Belting, et al. (2001. Dev 128:4165-4176.) report mapping the spgm793 mutant to LG21 between z12068 and z21718.
z12068 SSLP 21 Belting et al., 2001 Using a panel of 2418 spgm793/spgm793 embryos, Belting, et al. (2001. Dev 128:4165-4176.) report mapping the spgm793 mutant to LG21 between z12068 and z21718.
Genomic Feature e713 is an allele of pou5f3
Marker Type Chr Distance Publication / Person Comments
z13467 SSLP 21 Burgess et al., 2002 Burgess et al. (2002 Development 129:905-916) reported no recombinants between the SSLP z13467 and the spge713 mutant phenotype among 39 haploid embryos obtained from a heterozygous carrier female.
Genomic Feature e713 is an allele of pou5f3
Chr 21 Burgess et al., 2002 Burgess et al. (2002 Development 129:905-916) reported no recombinants between the SSLP z13467 and  ...
Genomic Feature m793 is an allele of pou5f3
Chr 21 Belting et al., 2001 Using a panel of 2418 spgm793/spgm793 embryos, Belting, et al.  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 796 BfaI 36.0
Forward Primer GCCCTTTGATGACGAGTGTG
Reverse Primer TTGGAGATGGGAGAGTGCAA
Genomic Feature hi349Tg is an allele of pou5f3