Morpholino
MO4-kdm1a
- ID
- ZDB-MRPHLNO-160208-3
- Name
- MO4-kdm1a
- Previous Names
- None
- Target
- Sequence
-
5' - GTTATTCACACCTTGTTGAGATTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-kdm1a
No data available
Phenotype
Phenotype resulting from MO4-kdm1a
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO4-kdm1a
1 - 5 of 5
Citations
- Wu, M., Chen, Q., Li, J., Xu, Y., Lian, J., Liu, Y., Meng, P., Zhang, Y. (2022) Gfi1aa/Lsd1 Facilitates Hemangioblast Differentiation Into Primitive Erythrocytes by Targeting etv2 and sox7 in Zebrafish. Frontiers in cell and developmental biology. 9:786426
- Wu, M., Xu, Y., Li, J., Lian, J., Chen, Q., Meng, P., Lu, T., Xie, H., Zhang, W., Xu, J., Zhang, Y. (2021) Genetic and epigenetic orchestration of Gfi1aa-Lsd1-cebpα in zebrafish neutrophil development. Development (Cambridge, England). 148(17)
- Takeuchi, M., Fuse, Y., Watanabe, M., Andrea, C.S., Takeuchi, M., Nakajima, H., Ohashi, K., Kaneko, H., Kobayashi-Osaki, M., Yamamoto, M., Kobayashi, M. (2015) LSD1/KDM1A promotes hematopoietic commitment of hemangioblasts through downregulation of Etv2. Proceedings of the National Academy of Sciences of the United States of America. 112(45):13922-7
1 - 3 of 3
Show