Morpholino
MO1-gata2b
- ID
- ZDB-MRPHLNO-150601-4
- Name
- MO1-gata2b
- Previous Names
- None
- Target
- Sequence
-
5' - TTCACGTCCTATTGGCACACGATGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata2b
No data available
Phenotype
Phenotype resulting from MO1-gata2b
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-gata2b
1 - 5 of 7 Show all
Citations
- Dobrzycki, T., Mahony, C.B., Krecsmarik, M., Koyunlar, C., Rispoli, R., Peulen-Zink, J., Gussinklo, K., Fedlaoui, B., de Pater, E., Patient, R., Monteiro, R. (2020) Deletion of a conserved Gata2 enhancer impairs haemogenic endothelium programming and adult Zebrafish haematopoiesis. Communications biology. 3:71
- Bonkhofer, F., Rispoli, R., Pinheiro, P., Krecsmarik, M., Schneider-Swales, J., Tsang, I.H.C., de Bruijn, M., Monteiro, R., Peterkin, T., Patient, R. (2019) Blood stem cell-forming haemogenic endothelium in zebrafish derives from arterial endothelium. Nature communications. 10:3577
- Butko, E., Distel, M., Pouget, C., Weijts, B., Kobayashi, I., Ng, K., Mosimann, C., Poulain, F.E., McPherson, A., Ni, C.W., Stachura, D.L., Del Cid, N., Espín-Palazón, R., Lawson, N.D., Dorsky, R., Clements, W.K., Traver, D. (2015) Gata2b is a restricted early regulator of hemogenic endothelium in the zebrafish embryo. Development (Cambridge, England). 142:1050-61
1 - 3 of 3
Show