Morpholino
MO5-cxcl8a
- ID
- ZDB-MRPHLNO-140630-1
- Name
- MO5-cxcl8a
- Previous Names
-
- MO cxcl8-l1 E1/I1 (1)
- Target
- Sequence
-
5' - GGTTTTGCATGTTCACTTACCTTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-cxcl8a
No data available
Phenotype
Phenotype resulting from MO5-cxcl8a
Phenotype | Fish | Figures |
---|---|---|
intersegmental vessel morphology, abnormal | i114Tg; y1Tg + MO5-cxcl8a |
Fig. S1 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO5-cxcl8a
1 - 5 of 10 Show all
Citations
- Farr, D., Nag, D., Chazin, W.J., Harrison, S., Thummel, R., Luo, X., Raychaudhuri, S., Withey, J.H. (2022) Neutrophil-associated responses to Vibrio cholerae infection in a natural host model. Infection and Immunity. 90(3):e0046621
- Zuñiga-Traslaviña, C., Bravo, K., Reyes, A.E., Feijóo, C.G. (2017) Cxcl8b and Cxcr2 Regulate Neutrophil Migration through Bloodstream in Zebrafish. Journal of immunology research. 2017:6530531
- de Oliveira, S., Lopez-Muñoz, A., Martínez-Navarro, F.J., Galindo-Villegas, J., Mulero, V., Calado, A. (2015) Cxcl8-l1 and Cxcl8-l2 are required in the zebrafish defense against Salmonella Typhimurium. Developmental and comparative immunology. 49:44-48
- Elks, P.M., van der Vaart, M., van Hensbergen, V., Schutz, E., Redd, M.J., Murayama, E., Spaink, H.P., Meijer, A.H. (2014) Mycobacteria Counteract a TLR-Mediated Nitrosative Defense Mechanism in a Zebrafish Infection Model. PLoS One. 9:e100928
- de Oliveira, S., Reyes-Aldasoro, C.C., Candel, S., Renshaw, S.A., Mulero, V., and Calado, A. (2013) Cxcl8 (IL-8) Mediates Neutrophil Recruitment and Behavior in the Zebrafish Inflammatory Response. Journal of immunology (Baltimore, Md. : 1950). 190(8):4349-59
1 - 5 of 5
Show