Morpholino
MO1-aggf1
- ID
- ZDB-MRPHLNO-130320-1
- Name
- MO1-aggf1
- Previous Names
- None
- Target
- Sequence
-
5' - GCCCTGCTCACCTGCTGTCGGAGAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aggf1
No data available
Phenotype
Phenotype resulting from MO1-aggf1
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-aggf1
1 - 5 of 18 Show all
Citations
- Yang, Z., Guo, D., Zhao, J., Li, J., Zhang, R., Zhang, Y., Xu, C., Ke, T., Wang, Q.K. (2023) Aggf1 Specifies Hemangioblasts at the Top of Regulatory Hierarchy via Npas4l and mTOR-S6K-Emp2-ERK Signaling. Arteriosclerosis, Thrombosis, and Vascular Biology. 43(12):2348-2368
- Wang, L., Wang, X., Wang, L., Yousaf, M., Li, J., Zuo, M., Yang, Z., Gou, D., Bao, B., Li, L., Xiang, N., Jia, H., Xu, C., Chen, Q., Wang, Q.K. (2017) Identification of a new adtrp1-tfpi regulatory axis for the specification of primitive myelopoiesis and definitive hematopoiesis.. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 32(1):183-194
- Kashiwada, T., Fukuhara, S., Terai, K., Tanaka, T., Wakayama, Y., Ando, K., Nakajima, H., Fukui, H., Yuge, S., Saito, Y., Gemma, A., Mochizuki, N. (2015) β-catenin-dependent transcription is central to Bmp-mediated formation of venous vessels. Development (Cambridge, England). 142(3):497-509
- Li, L., Chen, D., Li, J., Wang, X., Wang, N., Xu, C., and Wang, Q.K. (2014) Aggf1 acts at the top of the genetic regulatory hierarchy in specification of hemangioblasts in zebrafish. Blood. 123(4):501-8
- Chen, D., Li, L., Tu, X., Yin, Z., and Wang, Q. (2013) Functional characterization of Klippel-Trenaunay syndrome gene AGGF1 identifies a novel angiogenic signaling pathway for specification of vein differentiation during embryogenesis. Human molecular genetics. 22(5):963-976
1 - 5 of 5
Show