Morpholino
MO1-tbx5b
- ID
- ZDB-MRPHLNO-130123-3
- Name
- MO1-tbx5b
- Previous Names
- None
- Target
- Sequence
-
5' - GGATTCGCCATATTCCCGTCTGAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx5b
No data available
Phenotype
Phenotype resulting from MO1-tbx5b
1 - 5 of 48 Show all
Phenotype of all Fish created by or utilizing MO1-tbx5b
1 - 5 of 92 Show all
Citations
- Boyle-Anderson, E.A.T, Mao, Q., Ho, R.K. (2021) Tbx5a and Tbx5b paralogues act in combination to control separate vectors of migration in the fin field of zebrafish. Developmental Biology. 481:201-214
- Boyle Anderson, E.A.T., Ho, R.K. (2018) A transcriptomics analysis of the Tbx5 paralogues in zebrafish. PLoS One. 13:e0208766
- Steimle, J.D., Rankin, S.A., Slagle, C.E., Bekeny, J., Rydeen, A.B., Chan, S.S., Kweon, J., Yang, X.H., Ikegami, K., Nadadur, R.D., Rowton, M., Hoffmann, A.D., Lazarevic, S., Thomas, W., Boyle Anderson, E.A.T., Horb, M.E., Luna-Zurita, L., Ho, R.K., Kyba, M., Jensen, B., Zorn, A.M., Conlon, F.L., Moskowitz, I.P. (2018) Evolutionarily conserved Tbx5-Wnt2/2b pathway orchestrates cardiopulmonary development.. Proceedings of the National Academy of Sciences of the United States of America. 115(45):E10615-E10624
- Pi-Roig, A., Martin-Blanco, E., Minguillón, C. (2014) Distinct tissue-specific requirements for the zebrafish tbx5 genes during heart, retina and pectoral fin development. Open Biology. 4:140014
- Parrie, L.E., Renfrew, E.M., Vander Wal, A., Mueller, R.L., and Garrity, D.M. (2013) Zebrafish tbx5 paralogs demonstrate independent essential requirements in cardiac and pectoral fin development. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(5):485-502
- Chiavacci, E., Dolfi, L., Verduci, L., Meghini, F., Gestri, G., Evangelista, A.M., Wilson, S.W., Cremisi, F., and Pitto, L. (2012) MicroRNA 218 Mediates the Effects of Tbx5a Over-Expression on Zebrafish Heart Development. PLoS One. 7(11):e50536
1 - 6 of 6
Show