Morpholino
MO1-aldh1a3
- ID
- ZDB-MRPHLNO-120517-1
- Name
- MO1-aldh1a3
- Previous Names
- None
- Target
- Sequence
-
5' - TATAGTCCCGTTCTGTGCCATAGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aldh1a3
No data available
Phenotype
Phenotype resulting from MO1-aldh1a3
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-aldh1a3
1 - 5 of 23 Show all
Citations
- Burton, D., Zhang, C., Boa-Amponsem, O., Mackinnon, S., Cole, G.J. (2017) Long-term behavioral change as a result of acute ethanol exposure in zebrafish: Evidence for a role for sonic hedgehog but not retinoic acid signaling. Neurotoxicology and teratology. 61:66-73
- Zhang, C., Boa-Amponsem, O., Cole, G.J. (2017) Comparison of molecular marker expression in early zebrafish brain development following chronic ethanol or morpholino treatment. Experimental brain research. 235(8):2413-2423
- Zhang, C., Anderson, A., Cole, G.J. (2015) Analysis of crosstalk between retinoic acid and sonic hedgehog pathways following ethanol exposure in embryonic zebrafish. Birth defects research. Part A, Clinical and molecular teratology. 103(12):1046-57
- Maier, E.C., Whitfield, T.T. (2014) RA and FGF Signalling Are Required in the Zebrafish Otic Vesicle to Pattern and Maintain Ventral Otic Identities. PLoS Genetics. 10:e1004858
- Bohnsack, B.L., Kasprick, D.S., Kish, P.E., Goldman, D., and Kahana, A. (2012) A zebrafish model of Axenfeld-Rieger Syndrome reveals that pitx2 regulation by retinoic acid is essential for ocular and craniofacial development. Investigative ophthalmology & visual science. 53(1):7-22
- Ma, A.C., Chung, M.I., Liang, R., and Leung, A.Y. (2010) A DEAB-sensitive aldehyde dehydrogenase regulates hematopoietic stem and progenitor cells development during primitive hematopoiesis in zebrafish embryos. Leukemia. 24(12):2090-2099
1 - 6 of 6
Show