Morpholino
MO4-csf3r
- ID
- ZDB-MRPHLNO-120213-2
- Name
- MO4-csf3r
- Previous Names
- None
- Target
- Sequence
-
5' - ATTCAAGCACATACTCACTTCCATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-csf3r
No data available
Phenotype
Phenotype resulting from MO4-csf3r
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO4-csf3r
1 - 5 of 8 Show all
Citations
- Kwon, V., Cai, P., Dixon, C.T., Hamlin, V., Spencer, C.G., Rojas, A.M., Hamilton, M., Shiau, C.E. (2022) Peripheral NOD-like receptor deficient inflammatory macrophages trigger neutrophil infiltration into the brain disrupting daytime locomotion. Communications biology. 5:464
- Yang, L., Jiménez, J.A., Earley, A.M., Hamlin, V., Kwon, V., Dixon, C.T., Shiau, C.E. (2020) Drainage of inflammatory macromolecules from brain to periphery targets the liver for macrophage infiltration. eLIFE. 9:
- Hasegawa, T., Hall, C.J., Crosier, P.S., Abe, G., Kawakami, K., Kudo, A., Kawakami, A. (2017) Transient inflammatory response mediated by interleukin-1β is required for proper regeneration in zebrafish fin fold. eLIFE. 6
- Hall, C.J., Boyle, R.H., Sun, X., Wicker, S.M., Misa, J.P., Krissansen, G.W., Print, C.G., Crosier, K.E., Crosier, P.S. (2014) Epidermal cells help coordinate leukocyte migration during inflammation through fatty acid-fuelled matrix metalloproteinase production. Nature communications. 5:3880
- Hall, C.J., Flores, M.V., Oehlers, S.H., Sanderson, L.E., Lam, E.Y., Crosier, K.E., and Crosier, P.S. (2012) Infection-Responsive Expansion of the Hematopoietic Stem and Progenitor Cell Compartment in Zebrafish Is Dependent upon Inducible Nitric Oxide. Cell Stem Cell. 10(2):198-209
1 - 5 of 5
Show