Morpholino

MO1-uhrf1

ID

ZDB-MRPHLNO-120126-1

Name

MO1-uhrf1

Previous Names

None

Target

uhrf1 (1)

Sequence

5' - CACCTGAATCCACATGGCGGCAAAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-uhrf1

No data available

Phenotype

Phenotype resulting from MO1-uhrf1

Phenotype	Fish	Figures
brain decreased size, abnormal	AB + MO1-uhrf1	Fig. 4 from Chu et al., 2012
cardiac ventricle dilated, abnormal	AB + MO1-uhrf1	Fig. 4 from Chu et al., 2012
embryo development disrupted, abnormal	AB + MO1-uhrf1	Fig. 4, Fig. S4, Fig. S5 from Chu et al., 2012
eye decreased circumference, abnormal	AB + MO1-uhrf1	Fig. S4, Fig. S5 from Chu et al., 2012
eye decreased size, abnormal	AB + MO1-uhrf1	Fig. 4, Fig. S4, Fig. S5 from Chu et al., 2012
hemopoiesis disrupted, abnormal	AB + MO1-uhrf1	Fig. S7 from Deveau et al., 2015
hemopoiesis process quality, abnormal	sd2Tg; zf531Tg + MO1-uhrf1	Fig. 3 from Manesia et al., 2017
liver decreased size, abnormal	gz15Tg + MO1-uhrf1	Fig. 4 from Chu et al., 2012
midbrain hindbrain boundary morphology, abnormal	AB + MO1-uhrf1 + MO4-tp53	Fig. 4, Fig. S4, Fig. S5 from Chu et al., 2012
ventral wall of dorsal aorta myb expression decreased amount, abnormal	WT + MO1-uhrf1	Fig. 4 from Manesia et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-uhrf1	Fig. 5 from Manesia et al., 2017
whole organism dead, abnormal	AB + MO1-uhrf1 + MO4-tp53	Fig. 4, Fig. S5 from Chu et al., 2012
whole organism lcp1 expression decreased amount, abnormal	WT + MO1-uhrf1	Fig. 3 from Manesia et al., 2017
whole organism decreased life span, abnormal	AB + MO1-uhrf1	Fig. 4, Fig. S5 from Chu et al., 2012

Phenotype of all Fish created by or utilizing MO1-uhrf1

Phenotype	Fish	Conditions	Figures
whole organism dead, abnormal	AB + MO1-uhrf1	standard conditions	Fig. 4 from Chu et al., 2012
eye decreased circumference, abnormal	AB + MO1-uhrf1	standard conditions	Fig. S4 from Chu et al., 2012
midbrain hindbrain boundary morphology, abnormal	AB + MO1-uhrf1	standard conditions	Fig. 4, Fig. S4 from Chu et al., 2012
cardiac ventricle dilated, abnormal	AB + MO1-uhrf1	standard conditions	Fig. 4 from Chu et al., 2012
brain decreased size, abnormal	AB + MO1-uhrf1	standard conditions	Fig. 4 from Chu et al., 2012
eye decreased size, abnormal	AB + MO1-uhrf1	standard conditions	Fig. 4, Fig. S4 from Chu et al., 2012
whole organism decreased life span, abnormal	AB + MO1-uhrf1	standard conditions	Fig. 4 from Chu et al., 2012
embryo development disrupted, abnormal	AB + MO1-uhrf1	standard conditions	Fig. 4, Fig. S4 from Chu et al., 2012
hemopoiesis disrupted, abnormal	AB + MO1-uhrf1	standard conditions	Fig. S7 from Deveau et al., 2015
whole organism decreased life span, abnormal	AB + MO1-uhrf1 + MO4-tp53	standard conditions	Fig. S5 from Chu et al., 2012
whole organism dead, abnormal	AB + MO1-uhrf1 + MO4-tp53	standard conditions	Fig. S5 from Chu et al., 2012
eye decreased circumference, abnormal	AB + MO1-uhrf1 + MO4-tp53	standard conditions	Fig. S5 from Chu et al., 2012
midbrain hindbrain boundary morphology, abnormal	AB + MO1-uhrf1 + MO4-tp53	standard conditions	Fig. S5 from Chu et al., 2012
embryo development disrupted, abnormal	AB + MO1-uhrf1 + MO4-tp53	standard conditions	Fig. S5 from Chu et al., 2012
eye decreased size, abnormal	AB + MO1-uhrf1 + MO4-tp53	standard conditions	Fig. S5 from Chu et al., 2012
ventral wall of dorsal aorta myb expression decreased amount, abnormal	WT + MO1-uhrf1	standard conditions	Fig. 4 from Manesia et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-uhrf1	standard conditions	Fig. 5 from Manesia et al., 2017
whole organism lcp1 expression decreased amount, abnormal	WT + MO1-uhrf1	standard conditions	Fig. 3 from Manesia et al., 2017
liver decreased size, abnormal	gz15Tg + MO1-uhrf1	standard conditions	Fig. 4 from Chu et al., 2012
hemopoiesis process quality, abnormal	sd2Tg; zf531Tg + MO1-uhrf1	standard conditions	Fig. 3 from Manesia et al., 2017
hemopoiesis process quality, ameliorated	hsi1Tg; zdf13Tg + MO1-uhrf1	heat shock	Fig. S7 from Deveau et al., 2015

Citations