Morpholino
MO4-klf2a
- ID
- ZDB-MRPHLNO-101105-2
- Name
- MO4-klf2a
- Previous Names
- None
- Target
- Sequence
-
5' - AGCTGAGATGCATGGACCTGTCCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-klf2a
No data available
Phenotype
Phenotype resulting from MO4-klf2a
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO4-klf2a
1 - 5 of 5
Citations
- Steed, E., Faggianelli, N., Roth, S., Ramspacher, C., Concordet, J.P., Vermot, J. (2016) klf2a couples mechanotransduction and zebrafish valve morphogenesis through fibronectin synthesis. Nature communications. 7:11646
- Banjo, T., Grajcarek, J., Yoshino, D., Osada, H., Miyasaka, K.Y., Kida, Y.S., Ueki, Y., Nagayama, K., Kawakami, K., Matsumoto, T., Sato, M., and Ogura, T. (2013) Haemodynamically dependent valvulogenesis of zebrafish heart is mediated by flow-dependent expression of miR-21. Nature communications. 4:1978
- Vermot, J., Forouhar, A.S., Liebling, M., Wu, D., Plummer, D., Gharib, M., and Fraser, S.E. (2009) Reversing blood flows act through klf2a to ensure normal valvulogenesis in the developing heart. PLoS Biology. 7(11):e1000246
1 - 3 of 3
Show