Morpholino
MO7-cxcr4b
- ID
- ZDB-MRPHLNO-100608-10
- Name
- MO7-cxcr4b
- Previous Names
- None
- Target
- Sequence
-
5' - TTAATCACAAGCCAACTTACATCGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-cxcr4b
No data available
Phenotype
Phenotype resulting from MO7-cxcr4b
Phenotype | Fish | Figures |
---|---|---|
posterior lateral line primordium actin filament bundle organization process quality, abnormal | ui2Tg; zf106Tg + MO4-tp53 + MO7-cxcr4b |
Fig. 6 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO7-cxcr4b
1 - 3 of 3
Citations
- Xu, H., Ye, D., Behra, M., Burgess, S., Chen, S., and Lin, F. (2014) Gbeta1 controls collective cell migration by regulating the protrusive activity of leader cells in the posterior lateral line primordium. Developmental Biology. 385(2):316-27
- Gamba, L., Cubedo, N., Ghysen, A., Lutfalla, G., and Dambly-Chaudière, C. (2010) Estrogen receptor ESR1 controls cell migration by repressing chemokine receptor CXCR4 in the zebrafish posterior lateral line system. Proceedings of the National Academy of Sciences of the United States of America. 107(14):6358-6363
1 - 2 of 2
Show