Morpholino
MO2-ppp1r12a
- ID
- ZDB-MRPHLNO-100525-6
- Name
- MO2-ppp1r12a
- Previous Names
- None
- Target
- Sequence
-
5' - ATTTTTTGTGACTTACTCAGCGATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ppp1r12a
No data available
Phenotype
Phenotype resulting from MO2-ppp1r12a
1 - 5 of 16 Show all
Phenotype of all Fish created by or utilizing MO2-ppp1r12a
1 - 5 of 20 Show all
Citations
- Cayuso, J., Xu, Q., Addison, M., Wilkinson, D.G. (2019) Actomyosin regulation by Eph receptor signaling couples boundary cell formation to border sharpness. eLIFE. 8:
- Sahu, S.U., Visetsouk, M.R., Garde, R.J., Hennes, L., Kwas, C., Gutzman, J.H. (2017) Calcium signals drive cell shape changes during zebrafish midbrain-hindbrain boundary formation. Molecular biology of the cell. 28(7):875-882
- Gutzman, J.H., Sahu, S.U., Kwas, C. (2015) Non-muscle myosin IIA and IIB differentially regulate cell shape changes during zebrafish brain morphogenesis. Developmental Biology. 397(1):103-15
- Gutzman, J.H., and Sive, H. (2010) Epithelial relaxation mediated by the myosin phosphatase regulator Mypt1 is required for brain ventricle lumen expansion and hindbrain morphogenesis. Development (Cambridge, England). 137(5):795-804
1 - 4 of 4
Show