Morpholino
MO1-mir1-1,mir1-2
- ID
- ZDB-MRPHLNO-100422-2
- Name
- MO1-mir1-1,mir1-2
- Previous Names
-
- MO miR-1 (1)
- MO1-mir1-1
- Targets
- Sequence
-
5' - ATACATACTTCTTTACATTCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir1-1,mir1-2
No data available
Phenotype
Phenotype resulting from MO1-mir1-1,mir1-2
No data available
Phenotype of all Fish created by or utilizing MO1-mir1-1,mir1-2
1 - 5 of 7 Show all
Citations
- Wang, D., Weng, Y., Guo, S., Qin, W., Ni, J., Yu, L., Zhang, Y., Zhao, Q., Ben, J., Ma, J. (2019) microRNA-1 Regulates NCC Migration and Differentiation by Targeting sec63. International journal of biological sciences. 15:2538-2547
- Mishima, Y., Fukao, A., Kishimoto, T., Sakamoto, H., Fujiwara, T., and Inoue, K. (2012) Translational inhibition by deadenylation-independent mechanisms is central to microRNA-mediated silencing in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 109(4):1104-1109
- Stahlhut, C., Suárez, Y., Lu, J., Mishima, Y., and Giraldez, A.J. (2012) miR-1 and miR-206 regulate angiogenesis by modulating VegfA expression in zebrafish. Development (Cambridge, England). 139(23):4356-4365
- Mishima, Y., Abreu-Goodger, C., Staton, A.A., Stahlhut, C., Shou, C., Cheng, C., Gerstein, M., Enright, A.J., and Giraldez, A.J. (2009) Zebrafish miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. Genes & Development. 23(5):619-632
1 - 4 of 4
Show