Morpholino
MO6-tp53
- ID
- ZDB-MRPHLNO-100414-2
- Name
- MO6-tp53
- Previous Names
-
- delta113p53-MO (1)
- Target
- Sequence
-
5' - GCAAGTTTTTGCCAGCTGACAGAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5'UTR of the delta113tp53 isoform.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-tp53
No data available
Phenotype
Phenotype resulting from MO6-tp53
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO6-tp53
1 - 5 of 7 Show all
Citations
- Babu, S., Takeuchi, Y., Masai, I. (2022) Banp regulates DNA damage response and chromosome segregation during the cell cycle in zebrafish retina. eLIFE. 11
- Gong, L., Gong, H., Pan, X., Chang, C., Ou, Z., Ye, S., Yin, L., Yang, L., Tao, T., Zhang, Z., Liu, C., Lane, D.P., Peng, J., Chen, J. (2015) p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage. Cell Research. 25(3):351-69
- Shi, H., Tao, T., Huang, D., Ou, Z., Chen, J., Peng, J. (2015) A naturally occurring 4-bp deletion in the intron 4 of p53 creates a spectrum of novel p53 isoforms with anti-apoptosis function. Nucleic acids research. 43(2):1035-43
- Ou, Z., Yin, L., Chang, C., Peng, J., Chen, J. (2014) Protein Interaction Between p53 and Δ113p53 Is Required for the Anti-Apoptotic Function of Δ113p53. Journal of genetics and genomics = Yi chuan xue bao. 41(2):53-62
- Tao, T., Shi, H., Guan, Y., Huang, D., Chen, Y., Lane, D.P., Chen, J., and Peng, J. (2013) Def defines a conserved nucleolar pathway that leads p53 to proteasome-independent degradation. Cell Research. 23(5):620-634
- Chen, J., Ng, S.M., Chang, C., Zhang, Z., Bourdon, J.C., Lane, D.P., and Peng, J. (2009) p53 Isoform delta113p53 is a p53 target gene that antagonizes p53 apoptotic activity via BclxL activation in zebrafish. Genes & Development. 23(3):278-290
1 - 6 of 6
Show