Morpholino
MO1-csf3r
- ID
- ZDB-MRPHLNO-091229-1
- Name
- MO1-csf3r
- Previous Names
-
- gcsfrMo1 (1)
- Target
- Sequence
-
5' - GAACTGGCGGATCTGTAAAGACAAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-csf3r
No data available
Phenotype
Phenotype resulting from MO1-csf3r
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-csf3r
1 - 5 of 20 Show all
Citations
- Viana, F., Boucontet, L., Laghi, V., Schator, D., Ibranosyan, M., Jarraud, S., Colucci-Guyon, E., Buchrieser, C. (2023) Hiding in the yolk: A unique feature of Legionella pneumophila infection of zebrafish. PLoS pathogens. 19:e1011375e1011375
- Meier, A.B., Basheer, F., Sertori, R., Laird, M., Liongue, C., Ward, A.C. (2022) Granulocyte Colony-Stimulating Factor Mediated Regulation of Early Myeloid Cells in Zebrafish. Frontiers in bioscience (Landmark edition). 27:110
- Tsarouchas, T.M., Wehner, D., Cavone, L., Munir, T., Keatinge, M., Lambertus, M., Underhill, A., Barrett, T., Kassapis, E., Ogryzko, N., Feng, Y., van Ham, T.J., Becker, T., Becker, C.G. (2018) Dynamic control of proinflammatory cytokines Il-1β and Tnf-α by macrophages in zebrafish spinal cord regeneration. Nature communications. 9:4670
- Hasegawa, T., Hall, C.J., Crosier, P.S., Abe, G., Kawakami, K., Kudo, A., Kawakami, A. (2017) Transient inflammatory response mediated by interleukin-1β is required for proper regeneration in zebrafish fin fold. eLIFE. 6
- Halloum, I., Carrère-Kremer, S., Blaise, M., Viljoen, A., Bernut, A., Le Moigne, V., Vilchèze, C., Guérardel, Y., Lutfalla, G., Herrmann, J.L., Jacobs, W.R., Kremer, L. (2016) Deletion of a dehydratase important for intracellular growth and cording renders rough Mycobacterium abscessus avirulent. Proceedings of the National Academy of Sciences of the United States of America. 113(29):E4228-37
- Lévesque, M., Feng, Y., Jones, R., and Martin, P. (2013) Inflammation drives wound hyperpigmentation by recruiting pigment cells to sites of tissue damage. Disease models & mechanisms. 6(2):508-515
- Stachura, D.L., Svoboda, O., Campbell, C.A., Espín-Palazón, R., Lau, R.P., Zon, L.I., Bartunek, P., and Traver, D. (2013) The zebrafish granulocyte colony-stimulating factors (Gcsfs): 2 paralogous cytokines and their roles in hematopoietic development and maintenance. Blood. 122(24):3918-28
- Liongue, C., Hall, C.J., O'Connell, B.A., Crosier, P., and Ward, A.C. (2009) Zebrafish granulocyte colony-stimulating factor receptor signaling promotes myelopoiesis and myeloid cell migration. Blood. 113(11):2535-2546
1 - 8 of 8
Show