Morpholino
MO2-gmnn
- ID
- ZDB-MRPHLNO-090520-1
- Name
- MO2-gmnn
- Previous Names
-
- GemMO (1)
- Target
- Sequence
-
5' - CTTTGGTCTTCTGATGGAACTCATA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gmnn
No data available
Phenotype
Phenotype resulting from MO2-gmnn
1 - 5 of 26 Show all
Phenotype of all Fish created by or utilizing MO2-gmnn
1 - 5 of 36 Show all
Citations
- Yang, Y., Wang, H., He, J., Shi, W., Jiang, Z., Gao, L., Jiang, Y., Ni, R., Yang, Q., Luo, L. (2021) A single-cell-resolution fate map of endoderm reveals demarcation of pancreatic progenitors by cell cycle. Proceedings of the National Academy of Sciences of the United States of America. 118(25):
- Huang, S., Ma, J., Liu, X., Zhang, Y., and Luo, L. (2011) Geminin is required for left-right patterning through regulating Kupffer's vesicle formation and ciliogenesis in zebrafish. Biochemical and Biophysical Research Communications. 410(2):164-9
- Liu, X., Huang, S., Ma, J., Li, C., Zhang, Y., and Luo, L. (2009) NF-kappaB and Snail1a coordinate the cell cycle with gastrulation. The Journal of cell biology. 184(6):805-815
1 - 3 of 3
Show