Morpholino
MO2-fli1
- ID
- ZDB-MRPHLNO-081231-1
- Name
- MO2-fli1
- Previous Names
- Target
- Sequence
-
5' - TTTCCGCAATTTTCAGTGGAGCCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The morpholino has a single-nt mismatch at position 4 (C vs G in the reference genome and transcript population).
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fli1
No data available
Phenotype
Phenotype resulting from MO2-fli1
Phenotype | Fish | Figures |
---|---|---|
head hemorrhagic, abnormal | AB + MO2-fli1 |
Fig. S4
from Liu et al., 2008 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-fli1
1 - 5 of 5
Citations
- Neal, A., Nornes, S., Louphrasitthiphol, P., Sacilotto, N., Preston, M.D., Fleisinger, L., Payne, S., De Val, S. (2021) ETS factors are required but not sufficient for specific patterns of enhancer activity in different endothelial subtypes. Developmental Biology. 473:1-14
- Wythe, J.D., Dang, L.T., Devine, W.P., Boudreau, E., Artap, S.T., He, D., Schachterle, W., Stainier, D.Y., Oettgen, P., Black, B.L., Bruneau, B.G., and Fish, J.E. (2013) ETS Factors Regulate Vegf-Dependent Arterial Specification. Developmental Cell. 26(1):45-58
- Liu, F., and Patient, R. (2008) Genome-Wide Analysis of the Zebrafish ETS Family Identifies Three Genes Required for Hemangioblast Differentiation or Angiogenesis. Circulation research. 103(10):1147-1154
- Liu, F., Walmsley, M., Rodaway, A., and Patient, R. (2008) Fli1 Acts at the Top of the Transcriptional Network Driving Blood and Endothelial Development. Current biology : CB. 18(16):1234-1240
1 - 4 of 4
Show