Morpholino
MO1-sox18
- ID
- ZDB-MRPHLNO-080725-1
- Name
- MO1-sox18
- Previous Names
-
- MOsox18-ATG (1)
- Target
- Sequence
-
5' - ATATTCATTCCAGCAAGACCAACAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sox18
No data available
Phenotype
Phenotype resulting from MO1-sox18
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-sox18
1 - 5 of 43 Show all
Citations
- Arnold, H., Panara, V., Hußmann, M., Filipek-Gorniok, B., Skoczylas, R., Ranefall, P., Gloger, M., Allalou, A., Hogan, B.M., Schulte-Merker, S., Koltowska, K. (2022) mafba and mafbb differentially regulate lymphatic endothelial cell migration in topographically distinct manners. Cell Reports. 39:110982
- Chiang, I.K., Fritzsche, M., Pichol-Thievend, C., Neal, A., Holmes, K., Lagendijk, A., Overman, J., D'Angelo, D., Omini, A., Hermkens, D., Lesieur, E., Liu, K., Ratnayaka, I., Corada, M., Bou-Gharios, G., Carroll, J., Dejana, E., Schulte-Merker, S., Hogan, B., Beltrame, M., De Val, S., Francois, M. (2017) SoxF factors induce Notch1 expression via direct transcriptional regulation during early arterial development. Development (Cambridge, England). 144(14):2629-2639
- Overman, J., Fontaine, F., Moustaqil, M., Mittal, D., Sierecki, E., Sacilotto, N., Zuegg, J., Robertson, A.A., Holmes, K., Salim, A.A., Mamidyala, S., Butler, M.S., Robinson, A.S., Lesieur, E., Johnston, W., Alexandrov, K., Black, B.L., Hogan, B.M., Val, S., Capon, R.J., Carroll, J.S., Bailey, T.L., Koopman, P., Jauch, R., Smyth, M.J., Cooper, M.A., Gambin, Y., Francois, M. (2017) Pharmacological targeting of the transcription factor SOX18 delays breast cancer in mice. eLIFE. 6
- Koltowska, K., Lagendijk, A.K., Pichol-Thievend, C., Fischer, J.C., Francois, M., Ober, E.A., Yap, A.S., Hogan, B.M. (2015) Vegfc Regulates Bipotential Precursor Division and Prox1 Expression to Promote Lymphatic Identity in Zebrafish. Cell Reports. 13:1828-41
- Koltowska, K., Paterson, S., Bower, N.I., Baillie, G.J., Lagendijk, A.K., Astin, J.W., Chen, H., Francois, M., Crosier, P.S., Taft, R.J., Simons, C., Smith, K.A., Hogan, B.M. (2015) mafba is a downstream transcriptional effector of Vegfc signaling essential for embryonic lymphangiogenesis in zebrafish. Genes & Development. 29:1618-30
- Duong, T., Koltowska, K., Pichol-Thievend, C., Le Guen, L., Fontaine, F., Smith, K.A., Truong, V., Skoczylas, R., Stacker, S.A., Achen, M.G., Koopman, P., Hogan, B.M., and Francois, M. (2014) VEGFD regulates blood vascular development by modulating SOX18 activity. Blood. 123(7):1102-12
- Kartopawiro, J., Bower, N.I., Karnezis, T., Kazenwadel, J., Betterman, K.L., Lesieur, E., Koltowska, K., Astin, J., Crosier, P., Vermeren, S., Achen, M.G., Stacker, S.A., Smith, K.A., Harvey, N.L., François, M., and Hogan, B.M. (2014) Arap3 is dysregulated in a mouse model of hypotrichosis-lymphedema-telangiectasia and regulates lymphatic vascular development. Human molecular genetics. 23(5):1286-97
- Herpers, R., van de Kamp, E., Duckers, H.J., and Schulte-Merker, S. (2008) Redundant Roles for Sox7 and Sox18 in Arteriovenous Specification in Zebrafish. Circulation research. 102(1):12-15
1 - 8 of 8
Show