Morpholino
MO1-mab21l2
- ID
- ZDB-MRPHLNO-080407-1
- Name
- MO1-mab21l2
- Previous Names
- None
- Target
- Sequence
-
5' - ACTGTAGACCGGAGTTTCGCAGTAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mab21l2
No data available
Phenotype
Phenotype resulting from MO1-mab21l2
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-mab21l2
1 - 5 of 5
Citations
- Sribudiani, Y., Chauhan, R.K., Alves, M.M., Petrova, L., Brosens, E., Harrison, C., Wabbersen, T., de Graaf, B.M., Rügenbrink, T., Burzynski, G., Brouwer, R.W.W., IJcken, W.F.J.V., Maas, S.M., de Klein, A., Osinga, J., Eggen, B.J.L., Burns, A.J., Brooks, A.S., Shepherd, I.T., Hofstra, R.M.W. (2018) Identification of Variants in RET and IHH Pathway Members in a Large Family With History of Hirschsprung Disease. Gastroenterology. 155(1):118-129.e6
- Alvarez, Y., Cederlund, M.L., Cottell, D.C., Bill, B.R., Ekker, S.C., Torres-Vazquez, J., Weinstein, B.M., Hyde, D.R., Vihtelic, T.S., and Kennedy, B.N. (2007) Genetic determinants of hyaloid and retinal vasculature in zebrafish. BMC Developmental Biology. 7(1):114
- Kennedy, B.N., Stearns, G.W., Smyth, V.A., Ramamurthy, V., van Eeden, F., Ankoudinova, I., Raible, D., Hurley, J.B., and Brockerhoff, S.E. (2004) Zebrafish rx3 and mab21l2 are required during eye morphogenesis. Developmental Biology. 270(2):336-349
1 - 3 of 3
Show