Morpholino
MO1-klf6a
- ID
- ZDB-MRPHLNO-080208-5
- Name
- MO1-klf6a
- Previous Names
-
- KLF6a-atg (1)
- MO1-copeb
- Target
- Sequence
-
5' - CACATTGGTAGAACATCCATTGCAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino targets the transcription start site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-klf6a
No data available
Phenotype
Phenotype resulting from MO1-klf6a
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-klf6a
1 - 5 of 15 Show all
Citations
- Wen, L., Zhang, T., Wang, J., Jin, X., Rouf, M.A., Luo, D., Zhu, Y., Lei, D., Gregersen, H., Wang, Y., Wang, G. (2021) The blood flow-klf6a-tagln2 axis drives vessel pruning in zebrafish by regulating endothelial cell rearrangement and actin cytoskeleton dynamics. PLoS Genetics. 17:e1009690
- Xue, Y., Lv, J., Zhang, C., Wang, L., Ma, D., Liu, F. (2017) The Vascular Niche Regulates Hematopoietic Stem and Progenitor Cell Lodgment and Expansion via klf6a-ccl25b. Developmental Cell. 42(4):349-362.e4
- Xue, Y., Gao, S., Liu, F. (2015) Genome-wide Analysis of the Zebrafish Klf Family Identifies Two Genes important for Erythroid Maturation. Developmental Biology. 403(2):115-27
- Veldman, M.B., Bemben, M.A., and Goldman, D. (2010) Tuba1a gene expression is regulated by KLF6/7 and is necessary for CNS development and regeneration in zebrafish. Molecular and cellular neurosciences. 43(4):370-383
- Veldman, M.B., Bemben, M.A., Thompson, R.C., and Goldman, D. (2007) Gene expression analysis of zebrafish retinal ganglion cells during optic nerve regeneration identifies KLF6a and KLF7a as important regulators of axon regeneration. Developmental Biology. 312(2):596-612
1 - 5 of 5
Show