Morpholino
MO1-kdm6al
- ID
- ZDB-MRPHLNO-071029-2
- Name
- MO1-kdm6al
- Previous Names
-
- MO1-utxl1
- Target
- Sequence
-
5' - AGCTCCGAGCGTCCAAAAGCCACAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kdm6al
No data available
Phenotype
Phenotype resulting from MO1-kdm6al
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-kdm6al
1 - 5 of 7 Show all
Citations
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
- Lindgren, A.M., Hoyos, T., Talkowski, M.E., Hanscom, C., Blumenthal, I., Chiang, C., Ernst, C., Pereira, S., Ordulu, Z., Clericuzio, C., Drautz, J.M., Rosenfeld, J.A., Shaffer, L.G., Velsher, L., Pynn, T., Vermeesch, J., Harris, D.J., Gusella, J.F., Liao, E.C., and Morton, C.C. (2013) Haploinsufficiency of KDM6A is associated with severe psychomotor retardation, global growth restriction, seizures and cleft palate. Human genetics. 132(5):537-552
- Lan, F., Bayliss, P.E., Rinn, J.L., Whetstine, J.R., Wang, J.K., Chen, S., Iwase, S., Alpatov, R., Issaeva, I., Canaani, E., Roberts, T.M., Chang, H.Y., and Shi, Y. (2007) A histone H3 lysine 27 demethylase regulates animal posterior development. Nature. 449(7163):689-694
1 - 3 of 3
Show