Morpholino
MO1-mtor
- ID
- ZDB-MRPHLNO-070629-3
- Name
- MO1-mtor
- Previous Names
-
- MO1-frap1
- Target
- Sequence
-
5' - GGTTTGACACATTACCCTGAGCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mtor
No data available
Phenotype
Phenotype resulting from MO1-mtor
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO1-mtor
1 - 5 of 20 Show all
Citations
- Sun, X., Zhou, Y., Zhang, R., Wang, Z., Xu, M., Zhang, D., Huang, J., Luo, F., Li, F., Ni, Z., Zhou, S., Chen, H., Chen, S., Chen, L., Du, X., Chen, B., Huang, H., Liu, P., Yin, L., Qiu, J., Chen, D., Deng, C., Xie, Y., Luo, L., Chen, L. (2020) Dstyk mutation leads to congenital scoliosis-like vertebral malformations in zebrafish via dysregulated mTORC1/TFEB pathway. Nature communications. 11:479
- Chaturantabut, S., Shwartz, A., Evason, K.J., Cox, A.G., Labella, K., Schepers, A.G., Yang, S., Aravena, M., Houvras, Y., Mancio-Silva, L., Romano, S., Gorelick, D.A., Cohen, D.E., Zon, L.I., Bhatia, S.N., North, T.E., Goessling, W. (2019) Estrogen Activation of G protein-coupled Estrogen Receptor 1 Regulates Phosphoinositide 3-kinase and mTOR Signaling to Promote Liver Growth in Zebrafish and Proliferation of Human Hepatocytes. Gastroenterology. 156(6):1788-1804.e13
- Wang, Z., Song, J., Luo, L., Ma, J. (2018) Loss of Leucyl-tRNA synthetase b leads to ILFS1-like symptoms in zebrafish. Biochemical and Biophysical Research Communications. 505(2):378-384
- Zhang, Y.M., Zimmer, M.A., Guardia, T., Callahan, S.J., Mondal, C., Di Martino, J., Takagi, T., Fennell, M., Garippa, R., Campbell, N.R., Bravo-Cordero, J.J., White, R.M. (2018) Distant Insulin Signaling Regulates Vertebrate Pigmentation through the Sheddase Bace2. Developmental Cell. 45(5):580-594.e7
- He, J., Yang, Y., Zhang, J., Chen, J., Wei, X., He, J., Luo, L. (2017) Ribosome biogenesis protein Urb1 acts downstream of mTOR complex 1 to modulate digestive organ development in zebrafish. Journal of genetics and genomics = Yi chuan xue bao. 44(12):567-576
- Chu, C.Y., Chen, C.F., Rajendran, R.S., Shen, C.N., Chen, T.H., Yen, C.C., Chuang, C.K., Lin, D.S., and Hsiao, C.D. (2012) Overexpression of akt1 enhances adipogenesis and leads to lipoma formation in zebrafish. PLoS One. 7(5):e36474
- Makky, K., Tekiela, J., and Mayer, A.N. (2007) Target of rapamycin (TOR) signaling controls epithelial morphogenesis in the vertebrate intestine. Developmental Biology. 303(2):501-513
1 - 7 of 7
Show