Morpholino
MO3-irx1a
- ID
- ZDB-MRPHLNO-070613-1
- Name
- MO3-irx1a
- Previous Names
-
- irx1aATGMO (1)
- Target
- Sequence
-
5' - GGAAGACATCTCCTCCGCCACGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-irx1a
No data available
Phenotype
Phenotype resulting from MO3-irx1a
1 - 5 of 23 Show all
Phenotype of all Fish created by or utilizing MO3-irx1a
1 - 5 of 26 Show all
Citations
- Choy, S.W., Cheng, C.W., Lee, S.T., Li, V.W., Hui, M.N., Hui, C.C., Liu, D., and Cheng, S.H. (2010) A cascade of irx1a and irx2a controls shh expression during retinogenesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(12):3204-3214
- Cheng, C.W., Yan, C.H., Choy, S.W., Hui, M.N., Hui, C.C., and Cheng, S.H. (2007) Zebrafish homologue irx1a is required for the differentiation of serotonergic neurons. Developmental Dynamics : an official publication of the American Association of Anatomists. 236(9):2661-2667
- Cheng, C.W., Yan, C.H., Hui, C.C., Strähle, U., and Cheng, S.H. (2006) The homeobox gene irx1a is required for the propagation of the neurogenic waves in the zebrafish retina. Mechanisms of Development. 123(3):252-263
1 - 3 of 3
Show