Morpholino
MO1-amotl2a
- ID
- ZDB-MRPHLNO-070530-2
- Name
- MO1-amotl2a
- Previous Names
-
- amotl2MO1 (1)
- MO1-amotl2
- Target
- Sequence
-
5' - CTGATGATTCCTCTGCCGTTCTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-amotl2a
No data available
Phenotype
Phenotype resulting from MO1-amotl2a
1 - 5 of 43 Show all
Phenotype of all Fish created by or utilizing MO1-amotl2a
1 - 5 of 73 Show all
Citations
- Hildebrand, S., Hultin, S., Subramani, A., Petropoulos, S., Zhang, Y., Cao, X., Mpindi, J., Kalloniemi, O., Johansson, S., Majumdar, A., Lanner, F., Holmgren, L. (2017) The E-cadherin/AmotL2 complex organizes actin filaments required for epithelial hexagonal packing and blastocyst hatching. Scientific Reports. 7:9540
- Hultin, S., Subramani, A., Hildebrand, S., Zheng, Y., Majumdar, A., Holmgren, L. (2017) AmotL2 integrates polarity and junctional cues to modulate cell shape. Scientific Reports. 7:7548
- Agarwala, S., Duquesne, S., Liu, K., Boehm, A., Grimm, L., Link, S., König, S., Eimer, S., Ronneberger, O., Lecaudey, V. (2015) Amotl2a interacts with the Hippo effector Yap1 and the Wnt/β-catenin effector Lef1 to control tissue size in zebrafish. eLIFE. 4:e08201
- Hultin, S., Zheng, Y., Mojallal, M., Vertuani, S., Gentili, C., Balland, M., Milloud, R., Belting, H.G., Affolter, M., Helker, C.S., Adams, R.H., Herzog, W., Uhlen, P., Majumdar, A., Holmgren, L. (2014) AmotL2 links VE-cadherin to contractile actin fibres necessary for aortic lumen expansion. Nature communications. 5:3743
- Li, Z., Wang, Y., Zhang, M., Xu, P., Huang, H., Wu, D., and Meng, A. (2012) Amotl2 gene inhibits Wnt/beta-catenin signaling and regulates embryonic development in zebrafish embryoys. The Journal of biological chemistry. 287(16):13005-13015
- Wang, Y., Li, Z., Xu, P., Huang, L., Tong, J., Huang, H., and Meng, A. (2011) Angiomotin-like2 Gene (amotl2) Is Required for Migration and Proliferation of Endothelial Cells during Angiogenesis. The Journal of biological chemistry. 286(47):41095-104
- Huang, H., Lu, F.I., Jia, S., Meng, S., Cao, Y., Wang, Y., Ma, W., Yin, K., Wen, Z., Peng, J., Thisse, C., Thisse, B., and Meng, A. (2007) Amotl2 is essential for cell movements in zebrafish embryo and regulates c-Src translocation. Development (Cambridge, England). 134(5):979-988
1 - 7 of 7
Show