Morpholino
MO2-agrn
- ID
- ZDB-MRPHLNO-070411-2
- Name
- MO2-agrn
- Previous Names
-
- zfAgrinLG2-MO (1)
- Target
- Sequence
-
5' - CCTCTCCTTTACGCTGTGAAGACAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-agrn
No data available
Phenotype
Phenotype resulting from MO2-agrn
1 - 5 of 20 Show all
Phenotype of all Fish created by or utilizing MO2-agrn
1 - 5 of 30 Show all
Citations
- Zhang, C., Boa-Amponsem, O., Cole, G.J. (2017) Comparison of molecular marker expression in early zebrafish brain development following chronic ethanol or morpholino treatment. Experimental brain research. 235(8):2413-2423
- Zhang, C., Frazier, J.M., Chen, H., Liu, Y., Lee, J.A., Cole, G.J. (2014) Molecular and morphological changes in zebrafish following transient ethanol exposure during defined developmental stages. Neurotoxicology and teratology. 44:70-80
- Zhang, C., Ojiaku, P., and Cole, G.J. (2013) Forebrain and hindbrain development in zebrafish is sensitive to ethanol exposure involving agrin, Fgf, and sonic hedgehog function. Birth defects research. Part A, Clinical and molecular teratology. 97(1):8-27
- Zhang, C., Turton, Q.M., Mackinnon, S., Sulik, K.K., and Cole, G.J. (2011) Agrin function associated with ocular development is a target of ethanol exposure in embryonic zebrafish. Birth defects research. Part A, Clinical and molecular teratology. 91(3):129-141
- Liu, I.H., Zhang, C., Kim, M.J., and Cole, G.J. (2008) Retina development in zebrafish requires the heparan sulfate proteoglycan agrin. Developmental Neurobiology. 68(7):877-898
- Kim, M.J., Liu, I.H., Song, Y., Lee, J.A., Halfter, W., Balice-Gordon, R.J., Linney, E., and Cole, G.J. (2007) Agrin is Required for Posterior Development and Motor Axon Outgrowth and Branching in Embryonic Zebrafish. Glycobiology. 17(2):231-247
1 - 6 of 6
Show