Morpholino
MO1-szl
- ID
- ZDB-MRPHLNO-060818-2
- Name
- MO1-szl
- Previous Names
-
- szz MO (1)
- Target
- Sequence
-
5' - ACAGCAGCAGACTGAATAGAGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-szl
No data available
Phenotype
Phenotype resulting from MO1-szl
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism wholly ventralized, abnormal | WT + MO1-szl |
Fig. 4 
from Zhang et al., 2010text only from Dal-Pra et al., 2006 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-szl
1 - 3 of 3
Citations
- Zhang, J.L., Patterson, L.J., Qiu, L.Y., Graziussi, D., Sebald, W., and Hammerschmidt, M. (2010) Binding between Crossveinless-2 and Chordin von Willebrand factor type C domains promotes BMP signaling by blocking Chordin activity. PLoS One. 5(9):e12846
- Dal-Pra, S., Fürthauer, M., Van-Celst, J., Thisse, B., and Thisse, C. (2006) Noggin1 and Follistatin-like2 function redundantly to Chordin to antagonize BMP activity. Developmental Biology. 298(2):514-526
- Muraoka, O., Shimizu, T., Yabe, T., Nojima, H., Bae, Y.K., Hashimoto, H., and Hibi, M. (2006) Sizzled controls dorso-ventral polarity by repressing cleavage of the Chordin protein. Nature cell biology. 8(4):329-340
- Yabe, T., Shimizu, T., Muraoka, O., Bae, Y.-K., Hirata, T., Nojima, H., Kawakami, A., Hirano, T., and Hibi, M. (2003) Ogon/Secreted Frizzled functions as a negative feedback regulator of Bmp signaling. Development (Cambridge, England). 130(12):2705-2716
1 - 4 of 4
Show