Morpholino
MO1-cdh2
- ID
- ZDB-MRPHLNO-060815-1
- Name
- MO1-cdh2
- Previous Names
- Target
- Sequence
-
5' - TCTGTATAAAGAAACCGATAGAGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdh2
No data available
Phenotype
Phenotype resulting from MO1-cdh2
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-cdh2
1 - 5 of 60 Show all
Citations
- Matsumoto, K., Akieda, Y., Haraoka, Y., Hirono, N., Sasaki, H., Ishitani, T. (2024) Foxo3-mediated physiological cell competition ensures robust tissue patterning throughout vertebrate development. Nature communications. 15:1066210662
- Naganathan, S.R., Popović, M., Oates, A.C. (2022) Left-right symmetry of zebrafish embryos requires somite surface tension. Nature. 605(7910):516-521
- Aparicio, G., Rodao, M., Badano, J.L., Zolessi, F.R. (2021) Photoreceptor progenitor dynamics in the zebrafish embryo retina and its modulation by primary cilia and N-cadherin. The International journal of developmental biology. 65:439-455
- Balaraju, A.K., Hu, B., Rodriguez, J.J., Murry, M., Lin, F. (2021) Glypican 4 regulates planar cell polarity of endoderm cells by controlling the localization of Cadherin 2. Development (Cambridge, England). 148(14):
- Kesavan, G., Machate, A., Hans, S., Brand, M. (2020) Cell-fate plasticity, adhesion and cell sorting complementarily establish a sharp midbrain-hindbrain boundary. Development (Cambridge, England). 147(11):
- Tsai, T.Y., Sikora, M., Xia, P., Colak-Champollion, T., Knaut, H., Heisenberg, C.P., Megason, S.G. (2020) An adhesion code ensures robust pattern formation during tissue morphogenesis. Science (New York, N.Y.). 370:113-116
- Araya, C., Häkkinen, H.M., Carcamo, L., Cerda, M., Savy, T., Rookyard, C., Peyriéras, N., Clarke, J.D.W. (2019) Cdh2 coordinates Myosin-II dependent internalisation of the zebrafish neural plate. Scientific Reports. 9:1835
- Prince, D.J., Jessen, J.R. (2019) Dorsal convergence of gastrula cells requires a Vangl2 and adhesion protein-dependent change in protrusive activity. Development (Cambridge, England). 146(22):
- Rasouli, S.J., El-Brolosy, M., Tsedeke, A.T., Bensimon-Brito, A., Ghanbari, P., Maischein, H.M., Kuenne, C., Stainier, D.Y. (2018) The flow responsive transcription factor Klf2 is required for myocardial wall integrity by modulating Fgf signaling. eLIFE. 7:
- Mochizuki, T., Luo, Y.J., Tsai, H.F., Hagiwara, A., Masai, I. (2017) Cell division and cadherin-mediated adhesion regulate lens epithelial cell movement in zebrafish. Development (Cambridge, England). 144:708-719
1 - 10 of 36
Show