Morpholino
MO1-myd88
- ID
- ZDB-MRPHLNO-060719-1
- Name
- MO1-myd88
- Previous Names
- None
- Target
- Sequence
-
5' - TAGCAAAACCTCTGTTATCCAGCGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
inhibits translation
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myd88
No data available
Phenotype
Phenotype resulting from MO1-myd88
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-myd88
1 - 5 of 6 Show all
Citations
- Cafora, M., Brix, A., Forti, F., Loberto, N., Aureli, M., Briani, F., Pistocchi, A. (2020) Phages as immunomodulators and their promising use as anti-inflammatory agents in a cftr loss-of-function zebrafish model. Journal of cystic fibrosis : official journal of the European Cystic Fibrosis Society. 20(6):1046-1052
- Huang, C., Niethammer, P. (2018) Tissue Damage Signaling Is a Prerequisite for Protective Neutrophil Recruitment to Microbial Infection in Zebrafish. Immunity. 48:1006-1013.e6
- Mesureur, J., Feliciano, J.R., Wagner, N., Gomes, M.C., Zhang, L., Blanco-Gonzalez, M., van der Vaart, M., O'Callaghan, D., Meijer, A.H., Vergunst, A.C. (2017) Macrophages, but not neutrophils, are critical for proliferation of Burkholderia cenocepacia and ensuing host-damaging inflammation. PLoS pathogens. 13:e1006437
- Chang, M.Y., Cheng, Y.C., Hsu, S.H., Ma, T.L., Chou, L.F., Hsu, H.H., Tian, Y.C., Chen, Y.C., Sun, Y.J., Hung, C.C., Pan, R.L., Yang, C.W. (2016) Leptospiral outer membrane protein LipL32 induces inflammation and kidney injury in zebrafish larvae. Scientific Reports. 6:27838
- He, Q., Zhang, C., Wang, L., Zhang, P., Ma, D., Lv, J., Liu, F. (2015) Inflammatory signaling regulates hematopoietic stem and progenitor cell emergence in vertebrates. Blood. 125(7):1098-106
- van der Vaart, M., van Soest, J.J., Spaink, H.P., and Meijer, A.H. (2013) Functional analysis of a zebrafish myd88 mutant identifies key transcriptional components of the innate immune system. Disease models & mechanisms. 6(3):841-54
- Galindo-Villegas, J., García-Moreno, D., de Oliveira, S., Meseguer, J., and Mulero, V. (2012) Regulation of immunity and disease resistance by commensal microbes and chromatin modifications during zebrafish development. Proceedings of the National Academy of Sciences of the United States of America. 109(39):E2605-2614
- Liu, Y., Li, M., Fan, S., Lin, Y., Lin, B., Luo, F., Zhang, C., Chen, S., Li, Y., and Xu, A. (2010) A Unique Feature of Toll/IL-1 Receptor Domain-Containing Adaptor Protein Is Partially Responsible for Lipopolysaccharide Insensitivity in Zebrafish with a Highly Conserved Function of Myd88. Journal of immunology (Baltimore, Md. : 1950). 185(6):3391-3400
- Sepulcre, M.P., Alcaraz-Pérez, F., López-Muñoz, A., Roca, F.J., Meseguer, J., Cayuela, M.L., and Mulero, V. (2009) Evolution of lipopolysaccharide (LPS) recognition and signaling: fish TLR4 does not recognize LPS and negatively regulates NF-kappaB activation. Journal of immunology (Baltimore, Md. : 1950). 182(4):1836-1845
- Stockhammer, O.W., Zakrzewska, A., Hegedûs, Z., Spaink, H.P., and Meijer, A.H. (2009) Transcriptome profiling and functional analyses of the zebrafish embryonic innate immune response to Salmonella infection. Journal of immunology (Baltimore, Md. : 1950). 182(9):5641-5653
1 - 10 of 12
Show