Morpholino
MO1-glra4a
- ID
- ZDB-MRPHLNO-060706-1
- Name
- MO1-glra4a
- Previous Names
- Target
- Sequence
-
5' - TGATAATGAGAGAGAAATGCGTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-glra4a
No data available
Phenotype
Phenotype resulting from MO1-glra4a
1 - 5 of 41 Show all
Phenotype of all Fish created by or utilizing MO1-glra4a
1 - 5 of 43 Show all
Citations
- Bekri, A., Liao, M., Drapeau, P. (2019) Glycine Regulates Neural Stem Cell Proliferation During Development via Lnx1-Dependent Notch Signaling. Frontiers in molecular neuroscience. 12:44
- Bekri, A., Drapeau, P. (2018) Glycine Promotes the Survival of a Subpopulation of Neural Stem Cells. Frontiers in cell and developmental biology. 6:68
- Samarut, E., Bekri, A., Drapeau, P. (2016) Transcriptomic Analysis of Purified Embryonic Neural Stem Cells from Zebrafish Embryos Reveals Signaling Pathways Involved in Glycine-Dependent Neurogenesis. Frontiers in molecular neuroscience. 9:22
- Côté, S., and Drapeau, P. (2012) Regulation of spinal interneuron differentiation by the paracrine action of glycine. Developmental Neurobiology. 72(2):208-214
- McDearmid, J.R., Liao, M., and Drapeau, P. (2006) Glycine receptors regulate interneuron differentiation during spinal network development. Proceedings of the National Academy of Sciences of the United States of America. 103(25):9679-9684
1 - 5 of 5
Show