Morpholino
MO1-rbpja
- ID
- ZDB-MRPHLNO-060626-5
- Name
- MO1-rbpja
- Previous Names
- Target
- Sequence
-
5' - CGCCATCTTCACCAACTCTCTCTAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rbpja
No data available
Phenotype
Phenotype resulting from MO1-rbpja
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-rbpja
1 - 5 of 8 Show all
Citations
- Kuwabara, S., Yamaki, M., Yu, H., Itoh, M. (2018) Notch signaling regulates the expression of glycolysis-related genes in a context-dependent manner during embryonic development. Biochemical and Biophysical Research Communications. 503(2):803-808
- MacDonald, R.B., Randlett, O., Oswald, J., Yoshimatsu, T., Franze, K., Harris, W.A. (2015) Müller glia provide essential tensile strength to the developing retina. The Journal of cell biology. 210:1075-83
- Gajewski, M., Elmasri, H., Girschick, M., Sieger, D., and Winkler, C. (2006) Comparative analysis of her genes during fish somitogenesis suggests a mouse/chick-like mode of oscillation in medaka. Development genes and evolution. 216(6):315-332
- Sieger, D., Tautz, D., and Gajewski, M. (2003) The role of Suppressor of Hairless in Notch mediated signalling during zebrafish somitogenesis. Mechanisms of Development. 120(9):1083-1094
1 - 4 of 4
Show