Morpholino
MO1-smyd1b
- ID
- ZDB-MRPHLNO-060524-9
- Name
- MO1-smyd1b
- Previous Names
-
- ATG-MO smyd1 (1)
- Target
- Sequence
-
5' - ACTTCCACAAACTCCATTCTGGATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The sequence of this morpholino as reported by Tan, X. et al. (2006) contained a typographical error. The correct morpholino sequence, shown above, has been confirmed by the authors.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smyd1b
No data available
Phenotype
Phenotype resulting from MO1-smyd1b
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-smyd1b
1 - 5 of 16 Show all
Citations
- Li, B., Li, S., He, Q., Du, S. (2019) Generation of MuRF-GFP transgenic zebrafish models for investigating murf gene expression and protein localization in Smyd1b and Hsp90α1 knockdown embryos. Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology. 240:110368
- Gao, J., Li, J., Li, B.J., Yagil, E., Zhang, J., and Du, S.J. (2014) Expression and functional characterization of Smyd1a in myofibril organization of skeletal muscles. PLoS One. 9(1):e86808
- Li, H., Zhong, Y., Wang, Z., Gao, J., Xu, J., Chu, W., Zhang, J., Fang, S., and Du, S.J. (2013) Smyd1b is required for skeletal and cardiac muscle function in zebrafish. Molecular biology of the cell. 24(22):3511-21
- Xu, J., Gao, J., Li, J., Xue, L., Clark, K.J., Ekker, S.C., and Du, S.J. (2012) Functional analysis of slow Myosin heavy chain 1 and myomesin-3 in sarcomere organization in zebrafish embryonic slow muscles. Journal of genetics and genomics = Yi chuan xue bao. 39(2):69-80
- Tan, X., Rotllant, J., Li, H., Dedeyne, P., and Du, S.J. (2006) SmyD1, a histone methyltransferase, is required for myofibril organization and muscle contraction in zebrafish embryos. Proceedings of the National Academy of Sciences of the United States of America. 103(8):2713-2718
1 - 5 of 5
Show