Morpholino
MO1-dkk1b
- ID
- ZDB-MRPHLNO-060321-5
- Name
- MO1-dkk1b
- Previous Names
-
- MO1-dkk1
- Target
- Sequence
-
5' - GAGAGCATGGCGATGTGCATCATGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dkk1b
No data available
Phenotype
Phenotype resulting from MO1-dkk1b
| Phenotype | Fish | Figures |
|---|---|---|
| head truncated, abnormal | WT + MO1-dkk1b |
Fig. 5 
from Seiliez et al., 2006 |
| head morphogenesis disrupted, abnormal | WT + MO1-dkk1b |
Fig. 5
from Seiliez et al., 2006 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-dkk1b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| head morphogenesis disrupted, abnormal | WT + MO1-dkk1b | standard conditions |
Fig. 5
from Seiliez et al., 2006 |
| head truncated, abnormal | WT + MO1-dkk1b | standard conditions |
Fig. 5
from Seiliez et al., 2006 |
1 - 2 of 2
Citations
- Aman, A., and Piotrowski, T. (2008) Wnt/beta-catenin and Fgf signaling control collective cell migration by restricting chemokine receptor expression. Developmental Cell. 15(5):749-761
- Seiliez, I., Thisse, B., and Thisse, C. (2006) FoxA3 and goosecoid promote anterior neural fate through inhibition of Wnt8a activity before the onset of gastrulation. Developmental Biology. 290(1):152-163
1 - 2 of 2
Show